GenePrediction:GLEAN_1289 Details

Name: GLEAN_1289
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1881184..1882333 (+ strand)
Length: 1150
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1881184..1881502 (+ strand)
Length: 319
Type: CDS
Source: GLEAN
Position: GCSC_173:1881561..1881636 (+ strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_173:1881694..1881783 (+ strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_173:1881838..1882333 (+ strand)
Length: 496
>GLEAN_1289 class=GenePrediction position=GCSC_173:1881184..1882333 (+ strand)
ATGGAATCTCTCAACATCACTTCCACTTGGGACAACGAGGCTATCCGGGCAGCATGCACCACAGCTCGCAACTTCACCGA
TGCGCTCCCTCCAGGCAGCTTCTTGGCCGGGGCTCTGGGTCTCGGCTGGCTCTTCAACCGCTGGCTGACTGACAGGGCGC
TGAACAATGGCAATGCACTGGCAGAGTTTGATTGGATGCGTGAAATCATCGTCGTCACAGGAGGTTCTGGTGGCATTGGT
GCCGAAATAGTCAAAACACTGGCAGCCCGGGGGTCCAGAGTGGTCGTCCTCGACGTGCTCCCGCTGTCGTACCCGAAGAG
TGCGCGCGAAACGTCAAAACACGAATACAAGGCAGCGAGACCGCTGACAAAATGCAGGCCCCAACGTATACTACTACAAG
TGCGACCTGACCAACTACGACGAGTTGCAGGCAATGGCGACACGCATCCGAAAGTAAGCCATATTTACTCCCAGCTGCTT
TTAGCTGCCGCTAACATACTCTCTACCCAGAGACCTTGGTGATCCTACTGTGGTTGTAGCGAATGCGGGGATCTGTCGCG
GCAAGCCGATCTTGGCAGCCTCCCAGAGGGACATTGAGCTGTATGTTCCGTCCGCAAATCTGACATTCCCATCGGTGCTG
ACTCTTCTTTCCAGCACCTTTTCCGTCAACAACCTGGCAATGCTCTGGACGGCCAAGACCTTTCTGCCCAATATGATCAG
TAAGAATCATGGCCACCTGCTGATCGTGGCCTCCCAGACGGGCTATGTGGCCACACCAGGCCTTACCGATTATTCGGCCA
CCAAGGCGGCCGCCATTGCCATCTACGAGGGTCTCCATGCCGAAGTGAAGAATATCTACAAGGCGCCCTCGGTCCGCGTC
TCGTGCGTCTCGCCCAGCGCCGTCGACACGAAGATGTTCAGCGGCATCAAGCTGGGGTTGGGTATGAAAGCCCTGCGACC
GGAAGACCTGGGCGCCCTGATTGCCGACATACTCCACGGCGGTAGGTCCAAGCATACTATCGTGCCACGTTCCGCGTCTG
TCTTGTCCATCGTGCGAGCTCTGCCAGATTGGATACGGGTGGCGATGCAGACGGCTAGTGTCGGCGTTTTCACAGATCTG
CATCCACACGATCCCATGAAGGGGCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62