GenePrediction:GLEAN_128 Details

Name: GLEAN_128
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:862411..864178 (+ strand)
Length: 1768
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:862411..862542 (+ strand)
Length: 132
Type: CDS
Source: GLEAN
Position: GCSC_179:862801..862922 (+ strand)
Length: 122
Type: CDS
Source: GLEAN
Position: GCSC_179:862979..863015 (+ strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_179:863216..864178 (+ strand)
Length: 963
>GLEAN_128 class=GenePrediction position=GCSC_179:862411..864178 (+ strand)
ATGAGCAGTGTCAACGAAGAGAAAGGTCAAAGCCGGTTCTCCAGTGGTGATGGCAGCGCCCTGGACACTGCAGCCATAGG
CCTACCCCCAGATCCTGATGCTCATCTCAACAATGAAGAAAAGGCAGCTGTTGTGAGTTCGTTCGTGTCATGAGTACTGT
ATCTGTGGTTTACGTGTCGTATTAATCGCTGCATCATTATTTTCTAGGACCGAAAACTCGTCAGGCGACTTGATCTCATT
TTGATACCTTGGGTGAGTTGAAGCAGAAAAAGTATACGAAGAGTCATCCAACTAACCGCCACAAAGCTGTGTGTCTTGTA
TCTGCTTGCTTTTTTGGACCGTACGAACATTGGAAATGCCAAAATTGCCAACCTAAACACCGATTTGAAGCTTTCTACGA
GCCAGTACAACATGACTTTGACGATTTTCTTCATCTCATACTCTGTTTTTGAGCCCCTGACAAACATCATGCTCAAACGG
CTCCGACCGTCGGTGTTTATTCCCATCATCATGTGAGTTGAACCCCGTTTCACATTGACTTCACGCTCAGAATCTAACTG
GCTCTCAGGGTGGGATGGGGTGCTAGCATGTTGGGCATGGGTTTTGTCAAAGATTACTCTGGACTTTTGGCAGCTCGTTG
GTTCCTCGGTTTGTGTGAAGCTGGTCTTTTTCCTGGCATAAACTATTATCTGTCATGCTGGTATAAGAGATCTGAGTTTG
GTATACGGGCGGTAAGTGGATGCTTTAATCACGGAAGGCTCGCCAGACTTTCGGACAGACCACTAAGACTCTCAATTTGT
GACAGGCTATTTTCTTCTCCGCGGCTGCTGTTTCAGGATCCTTTGGGGGTCTCCTCGCTGCTGCCATCGAGCTGATGGAC
GGAATCCGTGGCCGTCCCGGTTGGGCGTGGATTTTTATTCTCGAGGGCCTTTTCACCATCCTTGCCGGTATTGTCTCGTT
TTTCTTGGTCCATGACTTTCCTGACAATGCCCGCTTCCTAACGTCTGATGACCGTGTCCGCGTTGTCCGGCGCCTGAAAC
TTGACCAGCAGTCCTCGGCTGAGCATGAGGAGTTTCGGATGTCATACTTCTGGTCAGCCGTCCGCGACTGGAAGATGTGG
CTGGGAATGGTCATCTATATGGGATGCGACATGCCGCTGTACGCCTTTTCACTGTTTCTTCCGTCCATCATCAAAAACTT
GGGCTGGAGCAGCTCAGTGGTTCACAGCCAGCTCATGTCGGTCCCACCATACGCAGCTGCAGCAATCTTGACCATCCTCA
TCGGGTACATTGCCGATCGGACCCATGCTCGCGGCCTCTGCAATATTGCCGTCTCGTTCTTTGGAATCGCAGGTTTCAGC
ATGCTCCTAGGCTCAGACAGACCTGGTGTTCAGTACGCCGGAACATTTCTGGGAGCCATGGGAATCTACCCATGCATTTC
AAACACGATCAGCTGGATGGCAAACAACATCGAGGGTGTTTACAAGCGCGGTGTGGTCCTTGGATTTGTCATTGGCTGGG
GCAATTTGAATGGGATTGTGTCGTCTAACATCTTCTTCGATTCGCCACGCTACTTTGTCGGCCATGGCCTAATTCTGGCT
TACATGGTTGTCTTTTTACTCGGAGGCTCCTTGATCATGACGATACTTCTGCGCAGAGAAAACAGCCGCCGGATACGGGG
CGAACGCAATGGGTGGACGGCAGGGCTGAGTGACAGTGAGATTGAAGCCCTCGGCGATAGACGTCCCGACTTCCTCTACA
CTACGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62