GenePrediction:GLEAN_1290 Details

Name: GLEAN_1290
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1893036..1894555 (+ strand)
Length: 1520
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1893036..1893182 (+ strand)
Length: 147
Type: CDS
Source: GLEAN
Position: GCSC_173:1893249..1893376 (+ strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_173:1893445..1893486 (+ strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_173:1893541..1893607 (+ strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_173:1893671..1893711 (+ strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_173:1893766..1893855 (+ strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_173:1893917..1894265 (+ strand)
Length: 349
Type: CDS
Source: GLEAN
Position: GCSC_173:1894319..1894555 (+ strand)
Length: 237
>GLEAN_1290 class=GenePrediction position=GCSC_173:1893036..1894555 (+ strand)
ATGGCTAAGCCCCGGGATACTGAAGAACAGATGCCGACCGCAGAAGTAGCTTCGGTCCCTGGAGCAACACAAGCTACTGT
CCCCGCGGCAGATCTCTCTAGCCAATTGCAACCCCCAGAGGTCTGGGCGAGTCTGGAGGTTTCAGAGGTATTGCAATGGC
TTAAAGGGCGGAGATTATCTCAGAAAGAAATTGGTCCTAATGTTTTTTTTTAGGATGAGAACGACTCGTCGTTTGGCGGA
GACATAGCTAGCTCTACGGAGTCTGTCAGATCGAGCATCTTGCAATACCGCGAACTTAACGGGCGCACATACCACCGCGA
GCGCACGGAAGGCACTTACTGGTATGCTAGTATTCGGAAGACTAAGAATCGTGTCTCAATGCGTGCACCCCACTAATGCA
GAACGCAAGGGGTCCTAATGACGACCGCCAGAACAATACGCTTGACGTTGGGTAAAATTTTTGGTCTAGACTATCAGTCC
TAATACTAAGCTGACATGGAAATAGACATCATGCACTCACCATGATAATGGGTGACAAACTCTACCACGCACCTTTGCCA
GACCATATGGACGTAAGGATTTGCCAAAGCACAAGCGCCAATACTCGCCATACCTAACGCGGTGGTTTATTACAGAAAGT
CCTGGATATTGGTACAGGAACTGGCATTTGGGCAATGTTTGTCACCCCTTTCTTTTTGTTCCATCGCGAGTATAAACTAA
GAAAGAAAAGCGACTTTGCAGACGAGCACCCTGAGGCGAACGTCATCGGAACCGATCTGTCTCCAATCCAGCCAGAATGG
GTTCCGCCCAATTTGTCCTTGTATTTCCTCCCATTCTAGCGTCGTGTCTCCCCTCTGTACATTTAACTCATAACATGCCA
GCCAAATCGATGACTTCACGGATTCGTGGACGTTTGAGGACAGCTCAGTCGACTTCGTACACTTACGCTGGTTATGCGGC
TCCGTAAAGAACTGGACAGAGCTTTTCAAACAGGCCTACAGGGTGCTTAAACCCGGTGGCTACATCGAAACCTTTGACTT
TGACGGCCACATCACGTCGGATGACGGTACCGTAACAGAAAAGACGGCGATATCACAATGGAGTCAAATTTTTGAAGGAG
GAGCCCGGAAGCTGGGCATGAACGTTTCTTTCAATCCTATAAAGGAAGGCTTGCAGCATAAGGCTCTTGTTGAAGCGGGC
TTTGTCAATATTACCGAGAAGGCGTACAAGGTCCGTCGGAATTGTCTTCTCACCAAAGAGATCTTGCTAATAAGCCGGTG
TAGCTCCCCATTTCGGAATGGTCAGATGACCCGCTACTGCACGAAGTTGGCCGGTACATGTATGTTACCCTGGCCAATGA
TACCGAGGGCTTTGTAGGCATGATGGCCACCTCGCTTGGATGGACCCCCGAGCAGATTAGCGTGTACGCAGCCCATGTCC
GTCGGGAGATGCGAGGGCTGAAGGTGCATGCCTACATCTACGGCGGTCTGGCCTACGCGCAGAAGCCGTTAGATGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62