GenePrediction:GLEAN_1292 Details

Name: GLEAN_1292
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1904920..1905602 (+ strand)
Length: 683
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1904920..1905061 (+ strand)
Length: 142
Type: CDS
Source: GLEAN
Position: GCSC_173:1905114..1905368 (+ strand)
Length: 255
Type: CDS
Source: GLEAN
Position: GCSC_173:1905430..1905602 (+ strand)
Length: 173
>GLEAN_1292 class=GenePrediction position=GCSC_173:1904920..1905602 (+ strand)
ATGAAGTTCTCCGTTTTCACTGCCGTGGCTTGCTTTGCTGCCAACGTCTTTGCTGCTCCGGCTAAGCGCGATGTCTCGGC
TGCCGTGATCGCCAAGCTTGAGACCACCCTCAACACGGCCATCACCGAGACTGCCACCATCCGTTAGTTTCCCATATTCC
AGCTGCCGTTGCTTCACATACTAACACGGAACAGACGCCGATGTCAAGGGTCTTCTCAACATTGGCGCCAACGTCGATGT
CGCCGCCAACCTGTCTGTTCTCACGTCTGACCTGGTCGTCCTGAACTCCACCCTCACCACGGTTGTCTCTGTCCTCGAGG
GCCTCGGTCTCACCGTTGACACCGAGGTCGACGCTCTGGTCTCTGCTGTGGGCGTGACTGTGGTCGGTCTGCTGGCTGAG
CTCCTGACTGACGTCACCAACCTCGTTGACTCTCTGACCGTTGTGGCTGGTAAGTCCCTTTGCTTTACTGAACCGTGATA
TCTCTTCAACACTCGCTCACACTTTCACAGACGTCACCGGAGATCTGAGCGTTGCCGGTCTTCTTGCCACTGGCGCCTCG
GTTGTTGCTACCGTCACCGCCACCCTTTCGCCCCTTGTCGTTGCTCTTGGCGCCGTCCTGAAGCTGGCCGTCTGCCTGCC
GATCGTCGGTCACGTTCTTGTCGGTGTCGTTGCCGTCCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62