GenePrediction:GLEAN_1293 Details

Name: GLEAN_1293
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1907603..1909456 (+ strand)
Length: 1854
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1907603..1907809 (+ strand)
Length: 207
Type: CDS
Source: GLEAN
Position: GCSC_173:1907870..1909456 (+ strand)
Length: 1587
>GLEAN_1293 class=GenePrediction position=GCSC_173:1907603..1909456 (+ strand)
ATGGGTTCTGTCGGCGATACAAAACGGGTGGACAGCGTACCGCTGCTAGACCGGCGCATTGAGCTGGTGGATCGGTTCAT
TGACGAGCCGCGGCCTCTGCGGGTAGCCGTGATCGGTGGCGGACTGACGGGCATCACGGCGGGCATCCTGCTGCCGGCAA
AGGTGCCGGGGATCCAATTGACGATCTACGAGAAGAACGAGGATTTTGTGAGTTGTCGGCCATCTCTCTGCGACCCCGCA
GCTCACACGCAGCTCTAACAGAAGCAGGGGGGCACATGGCTGGAGAACAAGTATCCGGGAGTGCGTTGCGACATTCCGTC
ACATGTTTATCAGTCGACGTTTGCGCCAAAGACAGACTGGACGGACCAGTTCTCGTACGGGCCAGAGATCCGAGAGTACT
GGCAGGGAGTGGCGCGGCAGCACGACGTGTACCAGTACGCGCAGTTTGGCAAGCGGGTGGAGGCGGCAGACTGGGACGAC
GAGGCGGGGGTGTGGACGCTGACGATCGAGGACGTGGCGACGGGCACACGGACGGCGACGGTGCAGGCAGACGCAGTAGT
GACGGCGGTGGGCCGGTTCAACGCATGGAAGCTGCCAGACTACCCGGGCATCAGCGAGTTCCAGGGGCTTCTGCGACACA
CGTCAGACTGGGATCCATCGTTTGACCCGACAGGCAAGCGGGTGGCGGTGATTGGGAATGGGGCGAGCGGGATCCAGGTG
GTGCCGGCACTGCAGAAGATTGCGGTCCGGGTGGACCACTACGCGCGCAGCCGGACATGGATTGCGACGTCGTGGGCAGG
CGACGAGCGGACGCCGGGGCCGCAGCCGATTGAAGAGAGCACCAAGGCGGCTTTGGGCGGCGATGCTGCGACGTATCTGC
GGTACCGCAAAGAACTTGAGGCCAAGTACTGGCGGCGGTTTGGCACGTTTCTGCGCGACGACGAGTCGGAAAGCGGGCGG
CGCGACAACGAGGCGCTGCGTACAGCGTTTTCCGAGGTGATGCGACGACGTATCGGCGACCGGAAGCCGGAGCTGCTGGC
CGACCTGGTGCCCGACTTTGCTCCCAACTGCCGGCGCCTGACGCCAGGTCCTGGCTACCTCGAGGCACTCACGGCCGACA
ACGTCGACTACGTGCGCACGCCCATTGCGCGTTTCACGGCCAGCGGGATCGAGACGACTGATGGAGTGCAGCGCGACGTC
GACGCCGTCTTCTGTGCCACCGGGGCCAACGTCGACATGGTGCCGGCCTTTGCAGTGCGAGCACGCGGCCAGGATCTGCG
GACGGTCTGGGGGGCTGACGGGACTCCCGGCAGCTACGGCTTCCCTTACACGTACCTCGGTGCGGCCACGCCCGGATTCC
CGAACCTGTTCTTTGTCCAGGGACCCCATGCGGCTGGTCCCAGCGGTACGGTTCCCCATGCAGTCGAGACCCAGCTCACG
TACGTGGCCCAGGTGCTGCGCAAGATCGGCCGCGAGGGCATCAAGGCCATGATGCCCAGCACGCGGGCGGCTGACGATTT
TGTCGTGTATGCGCGCTCGTTCTTTGACCGCACTGTCCTGACGGACAATTGCAGCTCCTGGTACAACAGCGGGCGACCCG
GCAGCTTCGTCCACGGCCTTTGGCCTGGCAGTGCTGGCCATCTCTCGGTCGTGCGGCGCAGCCCACGGTGGGAGGATTGG
GAGTACGACTATCTCGGTGGCGGAGGTGCGGACGCAAACCGCTTCGCCTGGTACTTTGGCAATGGCTGGACGCGCGACGA
GTCTAACCCCGAGGCTGACCTGGTCTCGTACCTCAAGCTGCCAGGCGAGGTGGCGCTTAAGGATTTGCACGAGGTCTGGT
GGGATCTGCCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62