GenePrediction:GLEAN_1294 Details

Name: GLEAN_1294
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1910043..1911838 (+ strand)
Length: 1796
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1910043..1910115 (+ strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_173:1910179..1910524 (+ strand)
Length: 346
Type: CDS
Source: GLEAN
Position: GCSC_173:1910576..1910588 (+ strand)
Length: 13
Type: CDS
Source: GLEAN
Position: GCSC_173:1910649..1910708 (+ strand)
Length: 60
Type: CDS
Source: GLEAN
Position: GCSC_173:1910763..1911521 (+ strand)
Length: 759
Type: CDS
Source: GLEAN
Position: GCSC_173:1911614..1911838 (+ strand)
Length: 225
>GLEAN_1294 class=GenePrediction position=GCSC_173:1910043..1911838 (+ strand)
ATGGCGTCACAGCAGAGCGGCGCTGCCGTTATCCCCAAGAAGCGGCTCATTGTGAATGCCTTTGTCGAGATGTGTTAGTG
GGGTCTCTTCCCCTCCTTCGTCTTAGGTGGTACTGACGTTTTATGCCAAACGACAGGCAGCGGCCACCAGTCGCCCGGCC
TCTGGAGACACCCAGACGACGAGTCGTCGCGCTTTGATGAGATCAGCCACTGGGTGGAGCTGGCCAAGCTGCTCGAGGAG
GCCAAGTTTCACGGCATCTTCATTGCCGACGTCTTGGGCGGCTACGACGTCTATAAGCACTCGCTCGAGCCCGCCATCGT
GTCTGGTGCCCAATGGCCCGTGACCGAGCCGCTGTCGATCGTGTCTGCCATGGCTGCCGTCACCAAGAACATTGGCTTTG
GCGTGACCGTCTCGACTACGTACGAGCAGCCCTACCACTTGGCTCGTCGCCTGTCGACTGTCGACCACCTGACCAAGGGC
CGGTGAGCATGGCCTCCAGTCTGCCTTGGCTGTGCGTTGCTAACATTGTTCAGGCTCGGCTGGAATGTGCGTGATGCGTG
TGTGTGTGTGTGTCTGAGCTCTACAACGGCCGGCTAACTCTTGCAGATCGTCACCAGCTACCTTGACTCGGCTGCCCGCA
ATCTAGGCCGAGCCGAACAGCCTGCTGTGCGTTCTTCTTCCCCCTTTCCGTCGGCCTATCTCGCTGACCTTTCTCCCCAG
CACGCCGACCGCTACTCCCAGGCGGAGGAGTACATCCGGATCATGTACAAGCTGTTCCAGTCGTCGTGGCGTGACGACGC
CGTGCGTCTGGACCGCAAGGCTGGCATCTACACGGATCCGGCCGCTGTCCGGCCGATCGACCACGCCGGCCAGTGGTTCA
ACGTCCCAGGCCCACACATTGTGCACCCGAGCCCGCAGCGGACGCCGTTGCTGCTGCAGGCCGGCACTTCGCCGGCCGGC
CGCAAGTTTGCCGCCCAGCACGCCGAGGCCATCTTTGTGTCGGCACATGCGCCGGCCGTCGTGGCTGCCAGCATCGCCGA
CGTCCGCCGTGCCGCCCGCGACGACTATGGCCGTGATCCCAGCCGCATCAAGGTCCTGGCCCTCGTCACTCCTATCCTCG
GTCACACCGCCGCTGAGGCTGCTGCCAAGCTCGCCGACTACCGCCGCTATGCCGACGCCGACGGCGCTCTCGCCCTCTTC
GGCGGCTGGACTGGCATCGATCTCGACCGCTACGGCGACGACCAGGAACTTCGCGAGGTCGACAGCAACGCCGTCCGCTC
TACCGTCGAGGGCTACGCCCGCTTCGCCCCTACCATCGGCCCTGATGGCGCCAAGACAAACGGCCGCTGGACCAAGCACA
CCGTTGCCGAACACGTCAGCATCGGCGGTAATGGGCCCCTCCTCGTTGGCACCGCTGCCCAGGTTGCCGATGCCCTCGAG
GCCTGGGTTGCCGAGGCCGACGTGGACGGCTTCAATTTTGTAGGGGCTTTTTTTTTTTTTTTCTTTCTATACCTCTGTTC
CTCCGTTTCCTTCGCTATTTGTCTCTTCTTATCCCATTCTAACACCAACAGGCCTACGCACTCTTCCCCCAATCCTTCAA
GGACATCATCGATCTGCTCCTCCCAGAGTTGCGCCGTCGCGGCCTCTTTTGGGATGATTATGCTGTTCCGGGCGGCACCT
ATCGTGAGAACTTCTATGAGACCAAGGGCCAGGCGCACCCGCTCAAGGAGCACGTGGCTGCTTCTTTCCAGTGGCGTGCA
GGTGTGCCTGCTAGCGAGCACCAAATTCCCAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62