GenePrediction:GLEAN_1295 Details

Name: GLEAN_1295
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1920648..1921746 (+ strand)
Length: 1099
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1920648..1920761 (+ strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_173:1920835..1920932 (+ strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_173:1921545..1921746 (+ strand)
Length: 202
>GLEAN_1295 class=GenePrediction position=GCSC_173:1920648..1921746 (+ strand)
ATGCCGTACCGATTCGAGCACCCTTACTTGATCCACCCGGCCACCCTGGACTGCGCGCTGCAGACGAGTTTACTGGCCCT
GGCGCCGGCCGGCACGGCGGTCGAGATGCCCAGGGTACTGACGGATCAGTCGTCCCCATTCGACGGAGATCACCAGACGC
GACCAATCATGCTCTGCTTCACCATAGAGTAAGAGCGACTTGCTGTACGACATATATCGCCCGGTGCTACGAGCACATGC
AGCCTACATGGACAAGCTGGCACACAAGGACCCACCCGACACTGCGTGTGCTGAAGATTAGAGTGGGCACAGCCAGCTCG
GCAGCTACGACGTTAGCAACCAGCTTTTTCGAGCTGGCGCGCTCGCTGCAGGTCCATAAGCTCGACATTCAGCAGTGTCC
GGCCGAGCAGGGCTTCGCCTCGGACACATACAACCGATAACGTGCTACATGCGACCAAGCAGATGCGCGTCACCCAGGAC
CACGTTCGGCGGCTGCTCAGAGCCGGCGACAAGCTGTTCACTCCAAGAATGGCGGCACGCATGGCGCGCGGGAGATCGAC
GGAAATGCTCTGGATTGGGTCTAGCAGACCGGATGTCGGACACGATGCCGGTGGACTAGTAAGGAGAAGCCGGCAAAATA
AGCCGGTCAACAGGACTAAATTAAAGTCTGTGGAGCATGGCTTCGCTAACGAGTTGGCTGCAACGACATATGTGGAGGCA
GTTCCAACTCATGGTTTGCAACAAGGTGTTCACCTGGCTTTCACCGTGGCAACATGTGCGCTGTCAGCAAGGATCACTTA
CGGCGCGTGCGCGCTAAAAGCCGAGGGCAACAAGACTGAGAGCGGAGCGACGGCTGTGACTGATGCGTTGTACACGGACG
TGTTGTTGTCCTTCTAGCCAGTTCCGGTGCTGCTGTCTGCGTATCGCCCGTGATTTTGCCACAGGATGGGACGAGCTGTG
CCTGCTGGCGCAAATGAGACGGAGGAAATCCGCCTGCGACACCATTGTCAGAGAAGTTACCGCCGGACTTGTGCGAGAGG
ACGAGAAGCAGCAAAACATTGTTGTGTGGCACAGGCCACCCGACCCACCTGTAGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62