GenePrediction:GLEAN_1298 Details

Name: GLEAN_1298
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1928682..1928986 (+ strand)
Length: 305
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1928682..1928874 (+ strand)
Length: 193
Type: CDS
Source: GLEAN
Position: GCSC_173:1928946..1928986 (+ strand)
Length: 41
>GLEAN_1298 class=GenePrediction position=GCSC_173:1928682..1928986 (+ strand)
ATGGAAAAGCAGCCCATCACCGAGGATCTGGCCAACGTGAAACCTATTCGGGGCGCACAGCCAAACTGCTTAGGGTATAC
GGATGACAAGGGCATCGAGCATAGTATTTACCTCCCCCAGGGCACTATGCATGCCGCGTACGACCACCTAGAGAACAAGC
GATGGGACGAGCTAGCAAAGTTTGCTCCGTACAGTAGGCTACACTCCGTCGTCGCGGCTAAGTATAGGTGTAAACTGTAC
GTCCTACTAACGCTTTTCTTCTAGCGGGTCAAGGATACAAGGATGAGGACTTCAAACATTACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62