GenePrediction:GLEAN_129 Details

Name: GLEAN_129
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:867653..870022 (+ strand)
Length: 2370
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:867653..867933 (+ strand)
Length: 281
Type: CDS
Source: GLEAN
Position: GCSC_179:867991..868192 (+ strand)
Length: 202
Type: CDS
Source: GLEAN
Position: GCSC_179:868251..868436 (+ strand)
Length: 186
Type: CDS
Source: GLEAN
Position: GCSC_179:868542..868894 (+ strand)
Length: 353
Type: CDS
Source: GLEAN
Position: GCSC_179:869035..870022 (+ strand)
Length: 988
>GLEAN_129 class=GenePrediction position=GCSC_179:867653..870022 (+ strand)
ATGAGCGAGAATGCAAGCCCATCAATGCAACTTACAAGAGAACAGGCGCAAGTCGTCGTCGCCGTGGAGCGGGCCGGCGC
ATCATTGTCCATGCTGGGTGTCGTGCTGATTATTGTTACCTTTGCGTCTTTCAAACGCCTGCGCAACGTGCCTAACACCT
TTATTCTTTTCGCCTCCATCGCTAACATTGGTGCCAGCATTGCCAGCCTCATCGGCCTGGCAGGAATCGCACAAGGCAGC
GAAAGTGCGCTGTGCCGAGCGCAAGCATTTTTGCTGGAGATGTAAGGGCTTCCTTCATTCTTCACATGATGCCGATACCT
TGCTCACACACTTGCCAGGTTTATGCAGTCTGACCCTTGGTGGTCATTTGCCATGGCTTTCAACGTCTTCCTCGTCTTTT
TCTTCTCGGCCAGCCCGACAACCTTCCGACGCCACCTGTGGGTATACTGTTTGGTGTGCTTTGGGCTGCCAATGATCCCG
GCTATTGTTTGCCTGTACATCAAGACCAAGAAACGGGGCCCGGTCTATGGCGATGCGACGGTGAGGCACTCTCATGATTT
CCTGGGCAGCGAGATACGTGGTGCTGACCGACCGACAGCTCTGGTGCTGGATCGGCGACGAGTGGAACTCGCTTCGCATC
TTCACATACTACATTCCCATATGGGTGTGCATCTTCTTCTCGGCCGTCATCTACGTCGCCGTCGGCTACTACGTTTTCCA
CCAGCGCAACCAGCTGCGCAATCTCAGTCTTAGCAACCCGGCCAAGGAAGCGTCAAGCTCCGAGGTAAGAGACTCAGCCG
AGAAGGTATCTGGGCTCCTCTCATTTTTGGAACTTGCCCTCATATTTCCCCCCCTTCAATCCCACTCCCTTCGTAGCTGA
TCTCGACAGAATCTGACCGGTGGCCAGCCCGGATTCTACGGCACCGTCACCACAGAAGTGCAGATCACTAGTGATGTCTG
CGACTCTACGCTCTCCGGAAATCGCACGCCACCATTGACCCCCATCGGCTCTCCTGCTCAGTGTCCTTGGGGTGACGGGC
CCTTCCCCCAGATTGCCACCAATATCCACCCTCAGCGCTTTCAGAACGCGCTCAAGCGGCCACTTTTAGACGAAGAGATG
GGTGCTATACCGTATTCTTCGTCCTCTTCGTCCCCACCGCCACCACCACCACCCCTGCTCTCCAATCATGGCTCCCGAGG
CTCTGCAATTAATGAATACCCCATGGCAACGACAACCCATCAGTGCCCACCCCCCCGCCTCTTGCTACTCCACCCGCAGC
AGCCTTCTCGACGTCCAAGCGGTTCAGACACCACCATCATTACCACCACCACCAACACCATCGCCGCCATCAGCCATTGC
AATCATTGCCTGAGACGAAAAGAACCAAGGCCTCTATCCGGTATGTCAACAATGCCGTCATCTCATCCAGCAACGTCACC
CCAAGCCATCGTCGACCCCAGCTGTCTCACTTTTCTGTCGGCGACCGTTTCTCTCGCGCTTGGCATCGAACATGGCGCCG
TATGTCTAGCAAGTTGCGCCACATGGACCCTATCAAGTTAGCATACCTGCGTACGTCGTTTGTCTTTGCCATCTCTGTGC
TTGTCACATGGACGCCCAGCTCCATCAATCGCATCTACGCTTTGTTGTATCCAACCCGCGTCAGTTACGGTCTTAATATT
GCCAGCGCTACCGTTCTCCCCTTGCAGGGTGTCTGGAACGCCGTCATCTACTTCACCACCAGTTGGGTACTGCTGCGTGA
GGAGGTGCGACGGCTAGGTTACCGGTCGCGCTGGTTCCGGCGGCTGGCTGTAAAATTGGGCATGGGTGCCATTGTGGGCG
TGGATGGTATTGCAAGCACGAGTGCTAGTGCTGGTTTTGGTGCAGGTGGAAGTATGCGTCTGAGAATTAGCCGTGGACGT
GTATACCCTGGAAACAGCCCTGGTCGCCCCTCTGCCGGTGGCAGCAGCAACTTGGGTGTTGTCGGTAGTGGCGACGGGGC
AGGTCCATCACGAGGCAGTCTTGCGGGGACGGGGAAGCCCGGTGGCGGTGGTGTTGATATGAGGCAGTGCAGCCGTACAA
AGCTGGACTCGGACTGTTTTGACGACGATAGCCGTGATGCCTCTCGTGACGCGAGCAGAGACCACGATGACAGCAACGGT
AATGACGATAACTATGGTGACAACTATCATGATGACGACACCGACGATGACAGCATCACCGATCATATGGGCAGGAGTAG
ACGCCGGCTTCGGCAGGGTACGAGTGTGAGCGCCAGTGCCAGCACTAGCACGGAGCCCGGGTTGGGAACGAGGGGGCCGC
CAGGCATCGGCACAATGCGGGTGCAAAAAGGCGGCCAGCTGGACACATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62