GenePrediction:GLEAN_1300 Details

Name: GLEAN_1300
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1948623..1949100 (+ strand)
Length: 478
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1948623..1948732 (+ strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_173:1948794..1949100 (+ strand)
Length: 307
>GLEAN_1300 class=GenePrediction position=GCSC_173:1948623..1949100 (+ strand)
ATGCAGTTCTTCGCCACCGCCCTCTTCGCTGCCGCCGTCGTTTCGGCTGACGCCGTGTTCCAAGTCACAAACTTTGCCGC
CGCTTGCGTCCCGCACAGCGTCGAATGCAAGTAAGTATCACGATAACCACGCATCATTCTTCCGTTCCTTATTCTTACAA
ACTTTCCTTAGGTACTCCTTCAATGTGATGCAGATGAATGCCGGCGAGACAGTCGCGAACATCTGCTCCGCCTCGGCTGT
CTCTTCCAACACCCTCCCCGCCATTACGGACGGCAAATGCAACAACTCTTACCGCACCTTCACCGTCACCCGCGACCACA
CCGCCGGCCTGACCCTCGCCGTGACCCAGATGGTTTCCCCCGCGAGCAACCAGGTGGCCACGCACCTTATTCCCCTGTCC
CAGATTACTACCACGAACGACAAGGTTGCCAACGTTGAGAGCTACAACGGCCCTACCAGCTTCACTCTCAGCGATTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62