GenePrediction:GLEAN_1301 Details

Name: GLEAN_1301
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1952205..1953146 (+ strand)
Length: 942
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1952205..1952237 (+ strand)
Length: 33
Type: CDS
Source: GLEAN
Position: GCSC_173:1952481..1952903 (+ strand)
Length: 423
Type: CDS
Source: GLEAN
Position: GCSC_173:1952976..1953146 (+ strand)
Length: 171
>GLEAN_1301 class=GenePrediction position=GCSC_173:1952205..1953146 (+ strand)
ATGGTGGAGAAAATTTACGTCACTTACAATGAGGTAAGATACAAAAACTCGAACCCGGGCCATGGCACCACCACAGGTGT
CGTGCATTGCGCGTGCCACGACACCTGCCGCTGTTGGTCTCGCACGGCACACAGTGCACGGAACACAGCACAGGGCTGCT
GCAGCCGCTAGCGCTTGCAGGGCACCTCTCTCTCTCTTCTGCGCTGTGTCTGGCCGTCAAAGAAGTGCCCACCCTTCTGA
TGTTGCTGACCCTTGGCCTCCTTTCTCCGCATACAGGTGCACCAGCTCTGCCAGGAGGCTGCAGGCCCGATCCTGGAGCG
GTTCCAGCCGCAGCTCATGATCGCCATTGGCGGTGGTGGCTACGTGCCGGCACGAATCCTGCGCTCGTTTCTCAAGAAGC
CCGGCTCGCCCAACATCCCGATCCAAGCCATCGGCCTGTCGCTCTACGAAAGCCTGCCGACTGACGACGTCGCCGAGGAG
CCTGGCACCAAGGTCACCCGCACCCAGTGGCTCGACCTGTCTAGCCTCGGCTCCATGAGCAATCTGGTCGGCAAGCGCAT
CCTGATCGTGGACGAGGTCGACGACACCCGCACCACGCTCGAGTACGCCGTCAAGGAGCTCGAGAAGGACGTCGAGACAG
CCCGGCTCGCAATTGGTCCCAACGCCGCCAAGACCGAATTCAGCATCTTTGTCCTCCATGTGCGTGTCCTCTTTCCCTGT
ATTGTATCACCTTTCAGATCATCTGGGCTGACACTCCCCTCTCCCTTTCAGAATAAGGATAAGGCAAAGAAGGGTGCCCT
CCCCAAGGAGATGATGGACTCGGGCCACTACATTGCTGCCCGCACCGTTGGTGACGTCTGGATCTGCTACCCGTGGGAGG
CAACAGACATTGAGGCTCACGACGCGGCGGCCCGGAAGCAGCTGACCAACGGCCAGAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62