GenePrediction:GLEAN_1302 Details

Name: GLEAN_1302
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1954661..1956877 (+ strand)
Length: 2217
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1954661..1956680 (+ strand)
Length: 2020
Type: CDS
Source: GLEAN
Position: GCSC_173:1956741..1956877 (+ strand)
Length: 137
>GLEAN_1302 class=GenePrediction position=GCSC_173:1954661..1956877 (+ strand)
ATGGACTCCCCGCCAAAAAAGCGGCGGAGGACGTCTCCGAGACTCTCCGACCGTGCCTCTGGAAATGACAGTCTCATGTA
CGATGTGAACACGGCTGCTTCCGCCACCCCGCCCGATCCTCCACGACCGTCTGTGTCGCCATCCCGGCCCCCATCGTTCG
CGTCTCCCACCAAGGCCAGTCTCGCCAGACACAACCAGGACGCTTTCGACCGGCGGCAACCGATGGCACGCAGCGAGGCT
AACGGCCGAAGGGGGGGCCCAACCGTCGTTTCTGCAGCGCCTCCTCCATCCAGCCACGCCGAAACAGACTCGGACGCGCA
AAGGGGAGCTAGGAAAAACGGAGCCGTTGGGGACATCGGTGAAATCCGCATGGCGCAGAGCGAACAGAACATACGACCAC
TTGCTCGCTCGCCTATACGGTCGCCGGCACGGTCGCCGACGCGGAGATTTGGCAGCACGTTGTCGGAGCCGCCCCGACGG
TCGCCCGTGAAGCCAATTCCGCGCCCGCTTCCACCCCCCGATCCACAGCGCAGCGAGGATGTTCTACAGCCGCTCATAGC
CCTCGACAGGCGGCGATCGGGGCTGGACTTGTTTCGCGGCGGTGATGAGCCGCCCGAGCCGGAGCTGCCGCCGACGCCAG
AACGCCCAGACCCCGAAATGGCTACGCCACCCAGTGGCATCCACAACAGCACGCCCACCAAACACCCGGGAAGGAGAAAG
GGCCGCGACAAGAAGGGCAGGGCGAGCAGCGGCTCGCCGCTGAAGCAGACGCCCCTCAAGGCAACAGCGCTTGCAGAAGC
AGAAGCAGGGGCACGGCTGAAAGACGCCGCCAAGCGGACCAAGGAACGGCCAGCCAACACGGAGAGCTCTGGCAGGCACA
GCCCACGACGACTGCGTAGCGGTCATGTCGCACGTGGCATAAAGCCTATGCAGCCGGACGCGGAGCTGCTGGCCGAGAAG
GCCTCGCTGCTGGCCGAGATCGCTCAGCTCGAGGCCGACCTGTCGTTCGTGGCGGCGGAGAACGAGAGAATACATAGCGC
CACGGTGCTCGGACTCGAGCCTTCTTCGCCCCAAAATCACCGAGACATTGTCAGCTTTCTTCGTCGCCATGTGCTGCCGC
CAGAGAAGGAAGCGCCAGACCCGACGGCGGACTGGCTGCAGGCGGCCACGAACCCGATTGCCTTTCTGCCCTTTGGCCAG
CCTTTGACGCAACTGACCAAACTCTTCACATTTGGCCAGCCGCAGACAGAAGGGACTGCCGAGGAGAACCCACCCATCTC
TCACCACCCCATACCCATGACGGCTGCCGAAGAGCTACCATATCTACAGGCGTTTAGCTCCCTCTCCTTCCGTTCCGAGG
TGATCGTGCTGCCGCCTGCAGAACCGGATGCACCCCTCTTGCAAAAGCACTGCATCACTGCCACGTCCATATCTCCACCC
GACGTCTTCCTGGCTCGTATAGAGATGATCGTCAACACTAAGTCTCTGCGCATAGCAGAGCTCCGCGTGCCGAAAATCGA
CCCGACAGCAGCTCCTGAGCTGCGGCCCTTTATCGACCGCATTGCTCTCTGCCACCAGAAAGATGCCGGCAGTGCACTGG
TTCGCAACGTCACTGTGCTAACGTGGGCCATGGGCGAGTGGGTGCGGGTAGCCGTCCGCCGAGCTAAGCTATGGTGTGCT
CTGGACCAGCTGGTTCGCGACAAGGAGGCCCTCCACAATGCAATTCAGGCCCTCCGCGCACGCAAGAAGCGAAGGTATAA
CAACAGGCGACGGGACGACAGCGATACTGACGATGACGACGAGCTTGGTGGCGATGTGCCGCAGAAAAGCTCTACATTTT
CAGCTACTGAGCTTCACGCTCATCTGGGCCGAACAGCTATGGATGTAGACATACCACTGCCCCAAAATGGCCAGGGACAC
GATGCTACACCCACCGTCCGCATACAGTGGCGCATTGACTTTGACTGGACTGGTGAAGCCCAAAGCGACTTGGGCCTGCT
CTTGGGCGTGCCGGGGAAGTGTACGTATAGCCACTGCATCATCTGCTACAATCACAAAACTAACATGTCGCGAATCACAG
GGCACAAAGCAGACGACAGAGGCCGTCTGGCCGGCCTGCCGAAGCTGTTCGACCAGCTTGTCCATGGAAGCGAGGACCCG
GAAACGGCCGTGAAGACAATTGTGGCTCTGCTAGCAGGCGATGATGATAGTGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62