GenePrediction:GLEAN_1303 Details

Name: GLEAN_1303
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1960830..1962822 (+ strand)
Length: 1993
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1960830..1961518 (+ strand)
Length: 689
Type: CDS
Source: GLEAN
Position: GCSC_173:1961576..1962206 (+ strand)
Length: 631
Type: CDS
Source: GLEAN
Position: GCSC_173:1962268..1962822 (+ strand)
Length: 555
>GLEAN_1303 class=GenePrediction position=GCSC_173:1960830..1962822 (+ strand)
ATGTCGAGTCGACTACCACCCGAAACCGCCCCTGATGGCGGTTTCGCGCCAGACGAGTCTCAATACTCCTCCATTGTGCA
CGCCTCCACCACCCAGCCACGCCGGGACAGCGATCTGACTCGGACTGCCTCGATCAGCCGCCCAATGACTGCTCTCGCCA
ATGCATCGCGCGCCCGCCGTGGCAGCCAGGCCAGCACCGGCTCCCGCTACGAGGCCACCAAGGCCCGGCGGGATCCCGAT
CTCGATATCAACCTGCCCTACCGCACCCTGAGCACCACCGCAAACATGGATGAATACCGCCGCGAGGTGCCTGGTGGTGA
GATGGTCGGTCCCGAAGAGCCCCCAGAGTTCGCTGCTGAGGCCGAACGTGCATCGTTGGCCGCCGGTCGTGCGCCCACCA
ATCAGTCTCGCCGTTTCCGTCTTGTCGCCTTCGAGCCAAATGACCCGGGAAACCCGAAGAACTGGAGCAAGATTTTCAAG
TGGTATATCACCATGGTCGTTGCTGTTACCTGTTTCGTCGTGGCTTTCGCTTCCAGTGTCGTCACTGCTGACATCAGCGG
TGTGATGGCCACGTTTGACGTTTCTGAGGAAGTGGTTCTGTTGACTATCACCCTATTCGTTATCGGCTTCGGTGTTGGTC
CCATGGCCTTTGCTCCCCTGTCCGAGGTCTACGGTCGCAAGATCATCTAGTAAGTCTCATCAATCGCTCCTTTGCATCAG
CGCAATTATATGCTAACCTTCGAAAGCGTTTCCACCTTGCTGGTCGCAGTCGTCTTCATCATTCCCTGCGCAGTTTCCAA
GAACATTGGTACACTGCTTGTCTGCCGTTTCATCGACGGTATCGCTTTCTCCGCACCCATGACACTCGTCGGCGGCACCC
TTGCGGACATGTGGCGGAATGAGGAGCGTGGTGTCCCCATGGCTGCATTCTCTGCCGCGCCCTTCCTTGGCCCTGCCATC
GGTCCTCTTGTCGGTGGCTATCTGTCTGACGCCAAGGGATGGCGCTGGCTGTACTGGCTGCAGCTTATCCTTGCTGGCTT
TGTCTGGTGTCTGCTTACCTTCACCGTCCCTGAGACATATGCGCCCAAGATTCTCCTGGATCGCGCCAAGAAGATGCGCA
AGGAGACTGGCGAGCTTGACTTTGTCACCGAGCAGGAGCTGGACACGCGCCCTATGTCGGAACGTCTCATGGTCTTCATT
GCCCGTCCGTTCCAGCTTCTCTTCACGGAGCTGATCGTCTTCCTGATCTCTCTCTATATGTCTGTCCTGTACGGTCTTCT
GTACATGTTCTTCGTTGCCTTCCCCATTATTTACCAAGAGGGCAAGGGCTACAACTCTGGCAAGACTGGCCTGATGTTTA
TCCCGGTTGCCGTTGGTGTAAGTTGCCTCCTGCGCGGTGTTTATACTCGTGAAATCTCAGCTGCTAACAGCATTATAGGT
CATCGCGTCTGCTGCATGCTCCCCTTTCGTCAACAACCACTACATTAAGATGTCGCATAAGTACAATGGCAAGCCGCCAG
CCGAGATCCGGCTGATTCCCATGATGTTGAGCTGCTGGTTCATTCCCATCGGTCTCTTCATCTTCGCGTGGACTTCGTAC
ACCGACATCTCTTGGGCTGGTCCCGCTATGGGTGGCTTCCCTGTCGGCTTCGGCTTCATTTTCCTGTACAACGCCGCCAA
CAACTACCTAGTCGACTCTTACCAGCACCAGGCTGCTTCTGCACTAGCAGCCAAGACCTGCATTCGGTCCTTCTGGGGTG
CCAGTGTCGTCTTGTTTACTGAGCAGATGTACCATCGCCTGAATGACCAGTGGGCCGGATCTCTTCTAGCCTTCATCAGT
CTTGCATGCTGTGCCATCCCCTTCTGCTTCTGGTTCTTCGGTGCCCGCATTCGGCAGCGGTCGAAGTATGCCTACAGCGG
TGACGACGATGAGGAGCCGACCAAGTCTGGTGGCAGCGACTCCGACCCCGAAAAGGCTGAACCTGCTCACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62