GenePrediction:GLEAN_1304 Details

Name: GLEAN_1304
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1967994..1969140 (+ strand)
Length: 1147
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1967994..1968076 (+ strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_173:1968178..1968472 (+ strand)
Length: 295
Type: CDS
Source: GLEAN
Position: GCSC_173:1968566..1968674 (+ strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_173:1968749..1969140 (+ strand)
Length: 392
>GLEAN_1304 class=GenePrediction position=GCSC_173:1967994..1969140 (+ strand)
ATGGAAAGCACAGCGGCCGATCAAGACTCCGTTATCTCGGACGCGTCATCGCTGTCAAAGCGCGAGCGGATGAAAACATT
TCTGTATGGAGCTCCGCAAGCACCGTCACCCACTTTTCAATATCTCTGTTCTCTGTACTGCGACTCGTCCAAGGCTGACT
TCAAGGGGGTTCGCGGGCGTGCAGGAAGGAAGAGTTGCACCAAGCTGGCGATGGACTCTTGAAAGGCAAGCTGAAGCTGG
AGCACTCGTTGGGCTTGGGACAAAAGCCGAACGTGATCCCGGCGGGCGAAGCGCAAATCCACTCCAATGAAGAGCGCGTG
GTTGAAATAGGCTGGCACCCGGTCGCCGGACTTGCCGGCAAATGGTTTGCCGAGAAGACGGGCCTCGGCCGCTTGATCAC
GGAGAAGATCAACAAGTACCCCGACCCGACGCAGCACTGGGCCGTGCTTGTTGGTGGCTATGTGCACCAGTTGTGGATGG
TAAGTGGAGGAGGGTAGAATCGAGGACTTCTTATTGACTCGATTTCGTACTTTCTTTCCCCCAGAAAAAGGCGCTGATCT
GATAGACAATAGGACGAGAGCCTCGACGTCATCTACATCAACGAGGAGCTTAAGCACGACGAGTGGCACACATATGAGGT
CGGAAAGACGCGCTTTAACGACGAAGCCATTCGACAAGCAGGTATGCCTTTTTGCTATATTACCTCCGTCGTATTGGCTT
TTATCGTATGACACGGTCCTCTAACAGTCTACCAGGCGAGATGGTCATCTTTAACATGCGCCAGAAACACCCTGGCTACA
ACCTCATCACCAACAACTGCCAAAACTTTGCATTACTTATGCTAGACGCCGTCCAGATCGGCAAGCACCGCCAGTTCGGG
TCCAGCTTTTCTATCTACCAGCGAGCTACCGGCGAGGGCACCATCGCCGATCTCTTCATCGATAATCCGTCACAGGACGA
GGAAGATGCCGCTGCCGCTATGGACGCCGAGGAGGCTGAAGAAGGCGAGGCGGCAGGAAGCCTCCCCGTACCTACGGAAG
AGGGTGCAGAGCCAAAGAAGAGCTACTTCAACAATATTCTCAAGAAGGCCCAGAAGGTTATGGAGGATAACACGACCAAG
CTAGATAGCCACCGCACGCTGCACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62