GenePrediction:GLEAN_1305 Details

Name: GLEAN_1305
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1970482..1973998 (+ strand)
Length: 3517
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1970482..1970782 (+ strand)
Length: 301
Type: CDS
Source: GLEAN
Position: GCSC_173:1971139..1972035 (+ strand)
Length: 897
Type: CDS
Source: GLEAN
Position: GCSC_173:1972099..1972637 (+ strand)
Length: 539
Type: CDS
Source: GLEAN
Position: GCSC_173:1972696..1972955 (+ strand)
Length: 260
Type: CDS
Source: GLEAN
Position: GCSC_173:1973021..1973358 (+ strand)
Length: 338
Type: CDS
Source: GLEAN
Position: GCSC_173:1973421..1973998 (+ strand)
Length: 578
>GLEAN_1305 class=GenePrediction position=GCSC_173:1970482..1973998 (+ strand)
ATGAACTCACCAAATTGGAAGGACGCTGGCCGTCTGGCCAGTTTTCTCCAGCCTTACGAAGAGGTCCTATCCTCACAAGA
AGCTGCTCAAGAAGATGCTGGTGAAGTCGAAAATTCGCTGATAGCAGCTCCGCCATACCCTTGGGCCAATCAAGGCAGTA
CTTCCATCGAAGAGCACATTGGAGTTCTCGAAGACGCCGTTATGGATGCCATCACATGCGGAAAACAATTAGTGAATGTG
GTGAAGGAGTTTGAAGTGGAGGGCAGAGCGACCTTCCCCCCATCTGTGGTGTCTGAAATTGGTTGGTCGATCCTGGACCT
ATCATGCTGTTGTCTAGTCTTATTCCATTGAAAAGCTAACCAAGCTTGCCGATAAAAACAGAGAATATCTGCGGTGAACA
TGACCAGTTTCATGTCTCAGTCGGTATTTGCGGAATGACAGGAGCCGGTAAGACAACCATCATTAATGCTCTTCTTGGCC
ATAATGACTTGCTTCCGCAGGGAAGTGAAGGGGCATCTACAGGAACCGTCTGTGTCGTGCATGAGAACAAAAACAAGAAC
GAGAGACCACGTTTTCACGCCCGGATTAGGTTCAAAAATAAGTCGGAGATAAAAAAGTGGCTGGACACGTTTTTCCGGGA
CTTCCATAATACCTCAGGCAAGAACGAAGGGCACGCGGAAGAATGTGATAATGAAAGAGATATTGATGGCGTTGATAGTG
ACATTGATGACGTCCTGATATGCGAGGTGACCCAGGTTTCTGGAAGCAGTGCCAAGGATGCCAGTGGAAGTGCTGGCCAA
GACGAGGATGATGAGGCAAACGATGAGAGCCAAGGTTTGGAGCATGATTTCAGTGAATTTACGGATCCAATTTTTGCTGT
ATGGAAGTTGGAAGAAGAGGATCTCAGAAGTATGACAACGGCCGACATTTTGACGGAGGCAGATCCTGCAACAGGGTTTC
TTTCGACAACAAAGTCGATCAGCTGCCAAGATCTAGAGACCTTTGCCGACGAGATCAAGCCGTTTCTCGACTGCACTCCA
CTTCCAGGCGTGGAGACAATAAATGGAGGAGAAATGCAGGTGTGGCCACTCGTGCAGCGTGTCGATCTCTATGTCCCGTC
GCCAATTTTGAAAAATGGAGTTGTGATCGAGGATCTTCCAGGCTTGTCTGATGCAGTGACGATGCGGGCGAATGTGGCCA
GAGAGAGGTTCACGGCGTTGGAAATCGCGATCATTGTATCACCCGTCTCTCGGGCAGGCGACGAGCAGCTGGCATCACAG
CTTATAAGCGACAACGAGGCTCTCCGAATGGAGCTCGATGGGAAGTTTACCCGTCACAATTTTTGTGTTGTGCCATCTAA
AATGGATGACATTCCCTGGGAACAATATCTGAAAAAGACGCTACGGCCTGCTGCCGGAACGGAAATACACACGGCACACA
AGGCGTACAAGGAGATCTGCCAACAGCTGAAAGAGATCAAGTCCAAAATGGGCGCGGCCAACAAAGAGTTGGAAGAGGCA
AGGGCTGACAGGAAGGTTCTACTCAAATGCGCGGGTGAGAATGTTTTCACACGTTTTGCTACGCGGGCCGACTACTAACA
CATAAGCCGATGCTTAGAAGACGGGCACGAACAGGCACGAGTCCAAGGAAGCGTATCGAGTGCCAGATCTAAGCTTGCCG
AGCTGACACAGCGGAACAGCAATCTCGAAGCACGGCTGACTTACTACAAAGGCCTCATGACATTTCTCTGCATCAAAGCT
AGAAACGCTAGGGTAGAAAAGAAGATCCTCATGGACATGAGGCGGAAAAAGGCACGATTTCGCAAGAACAAGACAGGGCC
ATTCACCGAGGAGGCTATAAATGTTCTTCCAGTCAGTTCTAGCTCGTTTTGGAACCTCCAGAACTCGGAATCAACTCCCA
GCCCCGGGTTTCCTGCGGTGGAGTACACTGGCATTCCAGCCTTGCGCGCCTGGATCAACAGAGCCACGATCCCGGCACGA
CAGAATCACGCGCTCTCGATTCTGCATCGTCTCAATGCAGTATTGAATGTCTTATGGACGTGGTCGATGGAAGAAAGCCT
CGACAGCCGCGACATGGTCTCACCAAAAGAAAGGCTAGAGGAGCTTTGCACAAAGTTCAAGAACACACTTCGCCAGGTGA
GCTACATGGTTGGAATAGCAGGCACTTGGGCTAACAGACCGGGCAACACAACAGAACCTCGGCGAGTATGGCGACGAGCT
CACGGCGCGCGTTCAGCAGTGCAATCCGCTCGCTATTCCTCCCAAACAGAGGTTTAAGCCACAATGCCGATCAAATGTCA
TAGAGGCAGTAAAGACCTGGAACTTGTTGTGGCCCAGCCGTCCACGTAGCCCAAAGATGCATTGGGCTACTCATTTAGCT
ATCATTCGTCGCAACGGCAAGCGGTACACCAGCACCGGTGCAGGTAGAGTTACTTACGCATGGATGGACAACATGTACGC
TGTTCTGGACCTTCCAATCTCCTCGTAGTTGTGATGCCCACACACTGACACAGAGCCAGGGCCGACGTGGTACTGCTTGG
TATTGTGGAAATGTGGAACGAAGCCTTTCACAGCAAGCTTCCTGCGGAGGCAGAGAAGGTCAAGGGCAGAATTGAGGAAA
TCTGGAACAGGTCGATGTTCAAGGTCCGATGGGCACTGCCGGCACTGTTTCCGACGCAGCTTGAGTACCTGTCGGGACAG
CTGGTTGCCATTATGGAGCTTCGTCAGTTAGTGGCTCATAATGTGGAAAACGCAATGTTTCGCATTGCTGTGCAGGCTGC
CGAAATCCACAAGCTTGTGGGAGAAATTCTATCTAAGAATTGGAGCCGTGGCTTCTTTGACGCACGGAAGATTATCGGTA
AGCAAGAGGTAGCATGGATGTGCCGCGCCTTTCTTTAGTGTTACTGACTTTGGCTACAGGAAAAGGCTCGTTCGGCTTGC
GCCAGAACCACTTCGAGAAGCTCGCGGACAAAAACACGACGCCCCTGGTCAAATTGGCAATGATGAAGATGGATCAGCAA
ATCATGGCGAACATGGACCACTTCCGGCAGTCTCTGGATGCCATCTGGGATGATGGACTGGCCAAGATCGATAACCAGAT
CGATGCCATTTGCCAGAGGATCGCCCAGGCAGAGCAAGACAGTGATGCAGCCGTCGAGACAGGCAGATCGACGGGTCTAG
AGCTTAGAAAGGCCGCAACACCACTGGTCATCAAGTGGCAAACGGACTGGAAGCTTCCCGACGTGATTGGTCGAATGCAG
GCCGGACTTGCAGACGCGGCCATCCCCAAAACATACGTCGACGAACCGAGAGGGGCGACCTTCGACCCCCTGAGCTCTGA
TGGGGAGGACTGGGCCTATGAACCGGAGCCGCCGAAGCCACCGAAGCGGCGCGTATACAAGAAGAGAATTCGGGACGAGG
GAGGAGAGGACACAAAGGTCAAGGTGGTACCCAAGAAGAGGGCACCGGCGAAAAAGAGGAAGACGGGGAACAATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62