GenePrediction:GLEAN_130 Details

Name: GLEAN_130
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:885174..886591 (+ strand)
Length: 1418
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:885174..885307 (+ strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_179:885379..885627 (+ strand)
Length: 249
Type: CDS
Source: GLEAN
Position: GCSC_179:885708..885974 (+ strand)
Length: 267
Type: CDS
Source: GLEAN
Position: GCSC_179:886042..886591 (+ strand)
Length: 550
>GLEAN_130 class=GenePrediction position=GCSC_179:885174..886591 (+ strand)
ATGGCCAATTTTCCCCCCAACAACGGCGGTATTCCTACCGAGTCCGCTACCACCCCTATTAACGGATCTCTTGACAACTC
CTTCCAGCAGGCTGCTTCCCTGCCGCAGGGCAGCGAGTCTTCGAAGACTCTCTGGTAAGCACCATATAAAAGCTGGTCTC
CAGCAACAATTGCTGCCGAAATAAGCTGACGTTCGTAAATTATAGGATGGGAGAACTTGAACCCTGGATGGACGAGAATT
TCGTCAAGAACGTTTTCAGCACCGTCTCAGGCGAGGCTGTCAACGTGAAGGTTATTCGCGACCGTGCGTCTGGAAATGCC
GGCTACTGCTTCGTCGAGTTTAACACTGCCGATGCCGCTACCAAGGCCCTGACGCTGAACGGCTCGCCTGTCCCTAACTC
TACTCGTGCTTTCAAGCTGAACTGGGCATCTGGTGGTGGACTCGTTGACCGTCGGTAAGCTATTTTCAGTCATGCTATCC
TATGTCTATGGTTTCTTGGGTTTGCATGAAGGCTAACATGCTATGATCTCTTAGTGACGACCGCAGTCCGGAGTTCAGCA
TCTTCGTCGGAGATCTGGGTCCGGAGGTGAATGAGTTTGTGCTTGTCAGCCTCTTCCAGGCCCGTTTCCCGTCCTGCAAG
TCGGCCAAGATCATGACCGATGCTGTCACTGGCCAGTCGCGTGGCTACGGATTTGTCCGTTTCTCCGACGAGACGGACCA
GCAGCGTGCTTTGGTCGAAATGCAGGGTGTCTACTGCGGCAACCGTCCCATGCGCATCTCTACGGCTACGCCTAAGACTC
GGTATGTGGTCCAGCCTCCCTTCCCCTCATTGACAGTGTAGAAAGGCATACTGACAGTGGTTCTACAGTTCCCACCAGTA
CGGCCAGGGTCAGCACGGTCAGCACATGCCTGCTCACGGTCCCGCTCAGGGCAACATGGGTTGGGGTGGCATGGGCAACG
GTGGCAACGGCGGCTATTACCAGCCTGGCTTCGGCCCCATGGCCCCCCAGCCCATGAACCAGTTCACGGACCCCAACAAC
ACCACTGTCTTTGTCGGCGGCCTCTCGGGCTACGTGACGGAGGATGAGCTCCGCTCTTTCTTCCAGGGCTTTGGCGAAAT
CACCTACGTCAAGATCCCCCCCGGAAAGGGCTGCGGCTTTGTCCAGTTCGTTCACCGTCATGCCGCTGAGATGGCTATCA
ACCAGATGCAGGGTTATCCTATCGGGAACTCCCGTGTCCGTTTGTCCTGGGGTCGTTCCCAGAACAACTCGGGCGTGGGC
ACCCCATACCGGCCTGCTCCGCCTCCGCCGCACTACCCTGTCCACGGCGCCATTCCCGGTGGCGTGAGTCCGTATGGTCC
GGGCCCATTCGGCACCGGCCACCAGGGCCCCCCTGGCCCCCCGCCTACTGGCGTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62