GenePrediction:GLEAN_1310 Details

Name: GLEAN_1310
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2001057..2003386 (+ strand)
Length: 2330
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2001057..2001896 (+ strand)
Length: 840
Type: CDS
Source: GLEAN
Position: GCSC_173:2002323..2002574 (+ strand)
Length: 252
Type: CDS
Source: GLEAN
Position: GCSC_173:2002624..2003179 (+ strand)
Length: 556
Type: CDS
Source: GLEAN
Position: GCSC_173:2003232..2003386 (+ strand)
Length: 155
>GLEAN_1310 class=GenePrediction position=GCSC_173:2001057..2003386 (+ strand)
ATGGACACCAATGGCAGCTGCGGTCCCATTGGCGATCAGTTCGCACAGCTGCCGCCCCTCCGAGATTGGATGCCCGATGA
TCTCGTTCAACTGCAATCTGCCGCACAAATGTTTAGCATAAACACGTCGAAGTTTCTCGAGTTCGGGACTAATTTTCGCT
CATATGACACGTCGGGCACCGGTCTCTGTCATGGAAAATCGAACAAGACGTGGACAAAAGAAGAATTTAGTCTTCTTATA
GACGCGGCCAGGATCATCGGCTGCGAGTTTTACATCCTGCTGCACTTTTGCGAGAGCTATCAGATGTCCTCGTTCCCGAG
GCCACCCACCGATGTCTATAGTAACAGTCCATCCACCGCCGACAACGGATCCGATAGAGATGTATCTAGCCAGCTAGATA
CGGGTAAACTTCCAACGCAAGTTTCGACGCTCGAGATGCTTCAGAATCCTGTTGGGGATCATGTTCCACAGCTCCAGAGT
GAAATGCGGACGGCAAACAGTGACCTGGGATTGCATGTCCCCTTTGAAGATAGCATTGGTTTTCATGAAAACGGCGATCT
AATTTTAAGCCCATACGACACAACATATCATGCTGACGATACTGATTTCGAATGGGGCGGTGTGCGACCACCAGGCCAGA
CTCTTGCGTCTGCTCCCCAATTGTCCTTTGACCAATCACATGAACACCTTCCCTATCACCCTCAAGCTGATTCGTTTTCA
CAACTTGATTATACCTGGCCTGTTTTGAACGATCTCTTAACTATCCCTGATAGTTCAAAGTCTGGGCCCTTTTGTGATGA
TGCGACGTCGCTCGACGTTCAGCAACCAGAGACGGAAGCCGTTAGTTTACACCCGATGACGATGACAAAGAGGCCCTGCA
AAGACCCCCCGCAAGGACATCATACCCAGAAAAGAAGAAAGACACTGGGGAAAGAGGCGGTCAAAACCTGCATTCGGTGC
AGTATAAAACATAAAAAGGTGAGAAAGTCTGATTGTTGTCATACGTCCTGCTCGAAATAACCGCTTCAGTGTGAACAAAG
CGACATTCCGAACATCTGTATAAATTGTCAGGGCTGCGACACTCTCAATAACAAACCCTGCTTCAAATTCGCCCTTCACA
CAGTCGTGTTATTTCGCACCATGACCGATCCCAAATTAAGTGACAAGCCATATGGCGAGCTGACACTCAACAACTGCATC
TGCAATCCACAACAACTCCAAATTTCCGATCCCGGAAGTACTACTATACTGTTTTCGATCAGGCAGGGCACACAAGGCCC
CGTTTTGGATCTGAGGGCCAGGCGGTTTGACGCAGGTAGTCTTCAGCAATCGACAGAGGCTGGGCGAAAGCTCTTTTCCC
ACCCCTATGCTCTTGCGGATATCAGCGAATTGAAGAAAACACTGTGGGAGTTCGTGATTGGAAATGGACACTCGTACATA
CAGCTCAAAGTCGACCAAGAAGACCAGCTTACAATGAGCTTCTTCAATCTGGCCACTGATATTGTGCGGGCTAAAGGGGT
GAGCATCTAAGTCTCCAACATTGATACCAATGGCTGACCTATGGCAGAATCACCACGGGTTTATCGCAAGCGTCCTGCGC
TTGTGGACGGCTGCCCGGACTCTAGAGGGTGACTGGCACTTCTCTGGAGAAGAATTTCTCGGTCTAGATCCAGGTAGGTA
TGACCGAGTGCCATTTACAAAGGCGCCTTTTATAGACTACCAATTTTCTGCCATCATGGCCGAATCTATCCTTCAGCCCC
TCAGAGAGCAGATCCTTAAAGAGCTGCATAAATTAGCACACAACAAGGCGAGAAAGAACTGGCTTGTCATCTTTGTTGCC
ACATATATTCTTCTCGACACGTACCGCTTGCTCTTCCGCCAACAAAGGGCCTATGCGGCTTCGAAGAAGGCCCCAGTACG
CTACAGCATGATGGAGTTGATCATAGACGCTCTTACGGGCGCCAAGACACTTCTAGGTTTTTACCATATAGTGTGCTGCA
GAAAGAAGCCGTTTGATTTGGATTGGAGTAGTCAGAATCCGATGACCTACAAATATCTCGGAGAAGTGACTGAGAAAGAG
ATACTGCATCTTAAGAACATCACAAGCTTGGTTAAACAGCAAAGTAAGTATTCTTGAAGGAGTCGATTGGAGTGTTCCTA
ACAGTCTCACCAAAGGTGCGAGGTTTAGGGCACTTGAAAACACAGACAAATACGAAGAAGATTACTGGTTCACCGGACAG
ATGTTTATCGATAATTGGACACCACCTACCACGATCGAGAAGTCCCCTCCTGCGACATTGCCTGTGCACGGCCCATGGCC
TGCCGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62