GenePrediction:GLEAN_1311 Details

Name: GLEAN_1311
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2003971..2006230 (+ strand)
Length: 2260
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2003971..2004045 (+ strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_173:2004109..2004122 (+ strand)
Length: 14
Type: CDS
Source: GLEAN
Position: GCSC_173:2004320..2004370 (+ strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_173:2004428..2005314 (+ strand)
Length: 887
Type: CDS
Source: GLEAN
Position: GCSC_173:2005383..2006230 (+ strand)
Length: 848
>GLEAN_1311 class=GenePrediction position=GCSC_173:2003971..2006230 (+ strand)
ATGTCGGCGAAACCTATGGTGGCTACGCAAGAGCGGCAGAAGCGACGCTCACGTCGGGCTATAAATGGCTGTGAGGTGGG
TCTAGGTCCTGACACCCTTTCAATCAAACCTGCGCTGAACACATCAACAATTCGACAGAACTGCCGGCTGAGGTGAGATT
GCGCATGTCGGGTACCGTTGGGACTCATCCTGACTGGTGGAACTGATTCTGTGTTTACCCCGTCCACTGCGCAGGCATCT
AAAATGTTGGTTTCTCTCGTGCTTCCGTGCAAAGACTCTTGACTGACTTTGGCGGAACTGTAGGCGATGACCGCAAGCCT
TCATGCCAACCCTGCATGACTGAGGGCAGAACATGCAACCGGAAGCTGCGCACGCAGTTTCGGCACAGATGGAATCCGTC
GTAAGTCGACAGGAACTGCATTGCGTTCATCGACTGGCCTCTCTGACCGTTGTCCAGAATACGGAGCGGCCACAATGGGA
AGGCGACTACACATGCCCTCTCGTACAGCTTTAAACCAGACCAGCCATGGTGTCGTACACGCCGGCCGCTGACGTTCGTG
AACGAGAATCGTGAGTTGCTGTCACTTTACGAAGACGGTCTCTCAGACGACGAAGCAGAAAGTGCAGCAGAAGCAGCAAC
CACAACAACAGAAGAGCCATCGGGGCTGCTCAGTCCCCCAGAAAATAATGATGTTGCATCTGGAAGCTATACGGCCGTGC
TTGCTAAAGAGCCGTCGAACTTGGACTGGCTGTCTCCCATCTCCCTCTCCCAGTCACCGTCACAATCGTCTACATTGATA
GCTAGATATAATGACGAAACGGCCTCGATTGCCGCGGCGGCTGCCGTTGCGGCCGTCACCACCGCTTCTGTCACCGCGGC
GGCTGCGGCTAATGCTGCTACAAGACCAGCCTATGCTGGCATCGGCATCAACCCCCTCATACACCCTCCAGAAGAACAGG
AACAGGAACAGCATCATCAGATGTCATCGAGAGTGGTACCGCCAGAGTTGCCCACATGGCCGCTCGAGAATAAAATGGAA
GCCTGTCTTTTCCGTTATTTTATTGAGTTGTCGGCCAAGTGGTTTGATCTCTGTGACCAAGAACGCACGTTTGCCGTCGT
GGTGCCATGCCGGGCGGTGCTTCATGCCCCGCTGATGAATGCCATCTTTGCAATCAGCGCCAGACACCTTAGCCTTATCA
GCTCGTTCAACAGGAGCATCTCAGACCGCTACTATGACCGCTGTTTGGCGACGTTGCGGCCGATGCTAAATGATAAGGGC
GCCCTCGTGGACGAGAACTTGTTTGCAGCTGCAGTGATCTTGCGGAATTTTGAGGAAATAGAAGGTGAATAGTTCACTTC
GCTTATTTTCCTCGTTGTATCTCTTCTAACAATTAAGTCCCTCTCGCCGGAGCACACCCGAGCACACATCTCCTAGGCAA
CAGTCTCTTTGTTAAGGCATCGGCTACCTTGCACGACTCGGCTGGGCTGTCTGCGCCGATTCTGTTCTCCGGTCTGAGAC
GTGCTGCGTTTTTGGTAGCCGTCCGTCAGGAAATTTACACCGCCTTCGTGTCGCAGCGGTCGATTTGTCCATCATTTAGT
CCCTTTGTTGTGGATCCCTCCCTGGATGTTGAAGGCAATGATTGCGACTGGGCCAACCGTGCTGTCTTTCATTTAGCTGA
TGTTCTGCGCTTCTGTTACGGTAAAGAACAGCCAGTGCCGCTGGATGACAGTCTTTGCCGTTATGACCAGCTTGTGGCCT
ACAGCCATCGTTGGTACGAGAAAAAGCCACTTAGCTTTTTACCGCTATATTACAAAGATCTCCTGGCAGACTTCTCGACA
ACATTAAACGATGTCGGAAGCATCCTCTTCCCCGAGATATGGCTCACATCTGACACTGTAGCCACTGGGCTGCAGCACTA
TCACCTTTCACGGATCTTGCTGGCTGCCTTCGATCCGCGAGCACCGCGGATCGGACCAGAACGCGCACAGTTTGCCCGGG
AGCAAGATGGCCGAATCCGTTCCGAGGTGCGCAATTTAGTCGGCATTGCAAAAAGTAACCCACACTGTCGACCCAACTTC
GTGTCGGCCTGCATGGGAATTGCCATGGCCGGTGAGCGTTTCCAGGAACGCTGGCAGCAGGAGTCCATCATGGGATTCCT
TGAAGAGACAGAGTCGCTTTGTGCTTGGCGCACACACACGGCCAGAGAACGTCTGTCGGCTGCATGGGGTTGGGACAACA
GGGACGGGGAGAAGAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62