GenePrediction:GLEAN_1314 Details

Name: GLEAN_1314
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2025685..2027018 (+ strand)
Length: 1334
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2025685..2025822 (+ strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_173:2025878..2025979 (+ strand)
Length: 102
Type: CDS
Source: GLEAN
Position: GCSC_173:2026030..2026127 (+ strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_173:2026263..2026332 (+ strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_173:2026444..2026484 (+ strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_173:2026549..2026665 (+ strand)
Length: 117
Type: CDS
Source: GLEAN
Position: GCSC_173:2026724..2027018 (+ strand)
Length: 295
>GLEAN_1314 class=GenePrediction position=GCSC_173:2025685..2027018 (+ strand)
ATGGCTGTGCGCGATGTCTACTATCCGCACATTATCACCTTCATAGTTCTCGACTCCATCGTTGTCGCTCTGCGCGTGTA
CACGCGCAGAGATACCAAGTCGCTCGGCATCGACGATGCCTTAATCGTGGTAGCTCTGGTATGTCTCCGTTCACGGTCGT
GCTGTCGCTAAGATTCGTTCTGACATGGTCAAGGTCGGCTTCGTCATCTTCGGTGCCATGGAGATGAGGGCCATACATTT
TGGGATTGGCTCCACCACCTTGGAGCCGATCTCCGACATGCTAAAAGCCGCCATGGTGGGTTCGAATCGGTCACTTCTCA
CAGTTTCGCGTCACTGACAGATCAGTACTTTACCATTGCGCAAATTCTCTACATTCTGTCCTCCGGTATCACCAAGCTGG
CCGTGGCCGTCGTGCTGTTACGCCTGACGAAGCACTCCGACATGTACGTGGCACGCGTCATCCTAATTGTCGTCATTGTC
GTCGTCGCCGTTTTCACCATCGGCGCCACTATCGTCTTTTCGTTGCAGTGTCGGCCGTTTTCCGTAGCCTGGGACGTCGG
CACGGGCACATGCCTCAGTACATCCACCATCGGCAAGGCTGCACTGGCGTTGTCCACTCAGGCTGTCGTCAGTAGCTGGT
TCAGTGCCGTGAGTTTCGTCTTCTCTTGCTATTTCGCCTCGATCCTCCGCCCTCGATCCGCTAACCGTCCATAATTTCTT
CCTGTCTACACGCTGTGGAAGACAAGCATTCCCTTAAAGGTCAAGATCACTACCATCGTCATTCTTGGACTGGGAGCCTT
GTACGTGCCACTGCCTGGGACTGGAAAGTACATGTCCTTTGATCTAACCTGCATCTATTTCCAGGACCTCTGTGGCGACT
ATCATTCGTCTCAAGTACGTTATCGTCATACAGCATATGCAGGGGAACGACAGCCTCTCTTCGGCTGACCTTATCAATAC
TGACCTCGAGGCTACCATTTAGTAAGTTCTATTTTTTCAGAGCCTGGCTGGCTGGCACATCCCACACTGACTCTTATAGC
TCTATTCTCGAAATCGCCTTCAGCATCTTGGCAGCAGCGATGGCTGCTTTACGGCCGCTTCTCCGCAAGATTCGCTTCTT
TTCTGACCTAAGTACGGGTGGAAAGTCAAACTCCAAGACCTCTGACTCCTACCACCTCCGCACTTTTGGCCAAGGAAGCA
GCCGCAACGCTGGTGGGGCCATCAAACTAGACGACGGCAGTCTTGACGGTGAGAGTCAGCGGGGGATTGTGACACCAGGG
CAGGAGACTGAGGACAGGAAGTTAGCCAGTGCCGGAGTACATGAAGAGTTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62