GenePrediction:GLEAN_1315 Details

Name: GLEAN_1315
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2034874..2037057 (+ strand)
Length: 2184
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2034874..2035269 (+ strand)
Length: 396
Type: CDS
Source: GLEAN
Position: GCSC_173:2036383..2037057 (+ strand)
Length: 675
>GLEAN_1315 class=GenePrediction position=GCSC_173:2034874..2037057 (+ strand)
ATGACTGGATTTCACAACGTAAGAGCCAAAAAGCCACGAGTGAGCAAAGTCGAGCAAGCTGAAGACGACCACGACGACAT
TGATAAGAAGCCCTTCAAACCAATGGAAATTGATATCGCCACTGGCCTAAAAAAGCTTCGAGACCACAAAAGCTTCTGGA
CTGAAGATGGCATCGAGCTCAAAGATCTAGCCAAGTTTGACGATTTGGGACCTTACGAAATCGATGAAGACACCGAAATG
GTTATGTGGCAGATTGAATTGAAACGGCTGGCTCAGGCAGCGGAGCAAGCCAATGCGCCGACCTTGGAAGGCGACCCAAA
GCTCTTTGGGCATGCTGACCAAGGTGGATACAACCGATTACATACGCTAGTATGGGCACTAGACCTTGCCAATATTGTTT
GTGGACTTGACATGGAAATTCTCCTTCTAAAGCACTGGCCAGCATTGGCTTCTGTCGAAAGAATACGTGATCTTCAGCTG
AAAAGCTCCATATTCGGTGGTTCCGATGCGGATAGCATTCGGGACAAAAGTATAGGAGAATTTGTAAAGAACAACAAGGA
AGCCTACCACGCAATTGTCAATTACATTACAGCTATCCTCGCGAGGACTTACATCCGGGTTGCCGAGAATCTGACATGGG
TAGAAAACTGTCTGGGTAGTCTGGCTAGATTATCAGCAAAGCTAAAAGTCGTTGGAAATGACATTCCTGGAGCAATCTCG
GATGTTTTGAACACTCGAAGATCCATGCAAAGACGTTTAACCCTTCACAAGCATAACGATGATACTCAACAAGACGTCAA
AAATCCTCACGGTCGAGCCTGGAATGACAGAAGGCATCTGCCAGGCTGGTTTTACTACATGACAAAAATGTTTTTTGCCC
AAAATGCGTCTTTGCTGTTTTGGCACATCTTGTCCGAGCTTACATGGGGTGCAGAGAGAAATCAAAGCAGCGATGACTTT
GAGGCCAGCGCTATCATATACCACACTGGATTCCGTCCTGCCCGGGGCCATCTCTGCCGAAAACTGACGGGTGGAATTGG
GGCAACAGGAAGCCGTCATGCGGTCCGATGTGCAGGGGTGGCCTTTGATGTGTGCAAGGACGTATGGACACAATTGAAAA
ATACGAGCGTACCAAAACCCGGTCTCGCAGTCCTAGATTGGAGCTGGACGGAGAATGCAAAGGGGGAGGTGCAGACGCAG
AGTCGCACGTTGGTCGATATGAAGCATGTCATTACCGCTCTGGTTCCCCACGCTATGTTTTGTGGCCAGTTTGTCTCTCG
TCTCTCGGACTTCTGCTTCCTTTCTATGCGTTCCAGACCATTAACACAGTCGACTACGTTCTACCTACCATCTGTCTTCC
TGGCGACATCGCGCATCTGTACAGGCAAATACACATCGAGAAAACTTAAGGAAAGTCAGACAGGAAAAAGTCTCCAATCT
CGCATCGAAGGGGTCTATGGAACGATGCTTGCACAGGAAAGAGCGTAAGCCTTGACAGTTGACGACCAGCTAAAAACGAA
ACGCCGCCAAAACTACGATGACACAAACCAAAAATACGAGCAGGCACTTGAGCAGGTCGGCGAATGGACCATTGATCGAA
ATTGCAACACCATCACTAGCGTCTGGTACTCGTATGCCGTCCTAGGCCTCGTTGGTTTGTTGATTATGGGTGGACTTGGG
CTCATGGCGTTGGGTCAGCGCATCACAGGCGTGGACCCGTCCAATTTGACGGTTCTGCTGTGGACGGCAGCCGGCTTTAT
CATGGTCTATCTCAAGTCGCGACACGTGGAGAATTGGCCCTGGCGTGACTTTATGCAAGGTCAAGTCGTCTGCCACTCTA
TAAGTGAGGTGGTGTCGGTGACCAAAATCGATCCTCAGATTCTGATTGCCGTCTTGATGCGCAACGAGACGCGCATGCAT
CTGGAGAAATCTGGACCGTTCGAAATGTTATTCGAATGCAGAGATACTAAAGGTTTCTCTATCGATGTGCCGCCGCTTGT
GACAACCGCCATGGCCGGGGGACGCATATTTGTCCGTGTTGATAGCGACAAGGGACCGGCCCTGGTGAGTATAGCAGTAA
CAACCCAGGACAATTACATGTCGGTGCCAGTTCACGGGTCCACTGAGACAGCGCTCATATGTCGCGCGATTTTACCGAGC
CTTCCAGTTGCCGCATGCGATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62