GenePrediction:GLEAN_1318 Details

Name: GLEAN_1318
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2047798..2055731 (+ strand)
Length: 7934
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2047798..2047969 (+ strand)
Length: 172
Type: CDS
Source: GLEAN
Position: GCSC_173:2048465..2048835 (+ strand)
Length: 371
Type: CDS
Source: GLEAN
Position: GCSC_173:2048894..2049159 (+ strand)
Length: 266
Type: CDS
Source: GLEAN
Position: GCSC_173:2049226..2054102 (+ strand)
Length: 4877
Type: CDS
Source: GLEAN
Position: GCSC_173:2054155..2055410 (+ strand)
Length: 1256
Type: CDS
Source: GLEAN
Position: GCSC_173:2055444..2055731 (+ strand)
Length: 288
>GLEAN_1318 class=GenePrediction position=GCSC_173:2047798..2055731 (+ strand)
ATGGCATTTGCCCTGATTGGGACAATCCAACTCGCCGTGAGCATTCGCCAGATCGAGAGCGAGACGACGCAGGCCTTCTT
GGGGACCTCCCCAACGCTCCCATATTTCTCTCTTCGTTGGGCCAGTGCGGGCAGTCGGCTGGTCTGGTGGGGGATCCACC
AGGAATCGACAGGTACCTGCTCGTGACCTCCAGCTGACCTTCAACGCGTAACGGTCCGCTGGGCTACTGGCCAGCCTGGC
CAATAGGACCTCTGCCCTCCCCCAGCTGGCAGCGCCTCGCCCGCCGGCCTGTCCACGCCAGGCTCGGCATCCGAGGTACC
CCAATGTACCCCCAATTCGCGCTAGCCTGCGACTCGTTCTTGCTCCAAGCTCCATTTCCTGCTCCGTGCTATTTTTCATT
ATAACACCCGTAAGAATTGCTCCAAATGCATCTCTCGTCCTTCATAAACACCTGTCCGTCTTCACTGCCCTTCCCTGCTG
TCTGGACGCTCCCCGTTCTTCCCAATCTTTCCGCTCCTCTTATTCCACATATCCGACTAGACGAAACGGGTCTATCCGCC
CTGTCGGGAGCTCTAACCCGCATTCTCTTCCTCTGCCCCTCGTAATACCCCCCCTCTTCTCGACCAGCTCGGCTTGTATA
TCTCTGGACGACCGATATACCTTGCAGCCGACCCGGTCGCTTCCCGTCAAGCCTCGCTTCCGATACCCACCGACAGGACC
ACCCCGTCGCCTCATCCCCGGCTGTCGTCTCTGCCAGAAGTCCTGGCCTCGGCCCTCCTTCTCTCCTCCCATGAGCAGAT
CCTGCTCGAGTCTCCCACCTTCACCATGACAGAAATCAGCGGCAGCAGCGCCGCCTCGCAATCCCGGCGCGGCACCGTGA
ACGGCTCGTCAGCACCACATGCCAACGGCAAGCCATCGTACACCGCGACGCGCAAGTTGCCCGACCATTTCATCGGCGGC
AACAAGCTGGACAGCGCACCCGACTCCAAGGTTAAGGACTTTGTCGCCAAGCACGACGGCCACACTGTCATCACAAACGT
ACGTCGCCCGCTTCCATCCCCTCCAGCCCGTCGGCAGCCCAGCTAACCCAGTCCAGGTCCTGATTGCCAACAACGGTATT
GCTGCCGTCAAGGAGATCCGCTCTGTCCGGAAATGGGCCTACGATGCGTTCGGCGACGAGCGCGCCATCCAGTTCACCGT
CATGGCTACTCCTGAGGATCTGCAGGCAAACGCCGACTACATCCGCATGGCCGATCACTATGTCGAGGTGCCCGGTGGCA
CCAACAACCACAACTACGCCAATGTCGAGCTGATCGTCGATGTGGCGGAGCGGATGGATGTCCACGCGGTGTGGGCCGGA
TGGTAAGACTTGATCGTGACCCATCTTCTGATTTTTCCATCGTTGCGACGCTGACATCATCGTTACAGGGGTCACGCCTC
CGAAAACCCGAAGCTGCCAGAATCCTTGGCTGCCTCGCCGAAGAAGATCGTGTTTATTGGGCCACCAGGCTCTGCCATGC
GCTCGCTGGGCGACAAGATCTCCTCCACCATTGTCGCACAACATGCAAAGGTGCCCTGCATCCCATGGTCCGGCACTGGT
GTCGACCAGGTCGCAGTGGGCGAAGGCGGCCTGGTCACCGTGGTCGACGAGGTCTACATGAAGGGCTGTGTGAACTCGTG
GCAGGAGGGCCTGGAGAAGGCCCACCAGATCGGCTTCCCCGTCATGATCAAGGCCTCGGAGGGCGGCGGCGGCAAGGGCA
TCCGCAAAGCCTCGAGCGAAGAGGGCTTTGAGCAGCTGTACAAGGCCGCGGCCAGCGAGATTCCCGGCTCGCCCATCTTC
ATCATGAAGCTGGCCGGCAATGCCCGGCATTTGGAGGTGCAGCTGCTCGCCGACCAGTACGGCAACAATATCTCGCTCTT
TGGCCGCGACTGTTCCGTCCAGCGTCGCCACCAGAAGATCATCGAGGAGGCACCCGTGACCATTGCCAACCAGACCACCT
TCCGTGCCATGGAAGAGGCGGCCGTGCGGCTTGGCAAGCTTGTCGGCTACGTCTCTGCCGGCACGGTCGAGTACCTATAC
TCGCACTCGGACAACAAGTTTTACTTCCTCGAGCTCAACCCCCGTCTGCAGGTCGAGCATCCGACCACGGAGATGGTCAG
TGGCGTGAACCTGCCTGCCGCCCAGCTCCAGATCGCCATGGGCATCCCACTGCACCGGATCAGCGACATTCGGCTACTGT
ATGGCGTGGACCCCAAGACCACGACCGAGATCGACTTTGAATTCAAGAACGAGGAGAGCGGCAAGACCCAGCGCCGGCCA
ACGCCCAAGGGACATACAACCGCCTGCCGGATCACTTCCGAGGACCCGGGCGAGGGTTTCAAGCCGTCCAACGGCGTGCT
GCACGACCTGAACTTCCGCAGTAGCTCCAACGTCTGGGGCTACTTTTCTGTCGGCACGGCTGGCGGCATCCACAGCTTCT
CCGACAGCCAGTTCGGCCACATCTTTGCGTACGGCGAGAACCGGTCGGCCTCGCGGAAACACATGGTCGTGGCCCTGAAG
GAGCTGAGCATTCGCGGTGACTTCCGCACGACCGTGGAGTACCTGATCAAGCTGCTCGAGACAGAAGCCTTTGAGGACAA
CACCATCACAACCGGCTGGCTCGACGAGCTGATCTCTAAGAAGCTCACGGCCGAGCGGCCTGACCCCGTCTTGGCCGTGG
TGTGCGGTGCCACTACCAAGGCCCATATTGCCAGCGAAGCCTGCATTGCCGAGTACCGCACCGGTCTGGAGAGGGGCCAG
GTCCCGTCCAAGGACATTCTCAAGACCGTCTTCCCCGTCGACTTCATCTACGAAGGCTTCCGGTACAAGTTCACCGTGAC
GCGGTCCAGCCTGGACAGCTATACCCTCTTTATCAACGGCTCTCGGTGTCTGGTCGGTGTCCGTGCCCTGAGCGACGGTG
GCCTGCTCATTCTCGTCGACGGCCGCAGCCACAACGTGTACTGGAAGGAGGAAGTCGGGGCCACGCGCCTCTCCGTCGAC
GGCAAGACCTGTCTGCTGGAGCAGGAGAACGACCCGACACAGCTGCGGACGCCGAGCCCGGGCAAGCTGGTCAAATACAC
GGTGGAGAGCGGCGACCATGTGTCGGCTGGCCAGACGTTTGCCGAGGTCGAGGTGATGAAGATGTACATGCCCCTGGTCG
CACAGGAGGATGGCTTTGTGCAGCTGATCAAGCAGCCTGGCTCGACGCTGGAAGCCGGCGACATCCTCGGCATCCTAGCC
CTGGACGACCCGAGTCGTGTGAAGCAAGCCCAGAGCTTTGTCGAGAAGCTGCCCGACTTGGGCCCGCCCGTTGTTGTCGG
CACCAAGCCGTCGCAGCGGTTCGCGGTGTTGTACAGCATTCTCGAGAACATCCTGCGCGGATACGACAACCAGATGGTCA
TGGTGCAGACGCTGACCAAGCTTGTCGAGGTGCTGCGGGACCCGTCGCTGCCCTTTAGCGAGTGGAACGCGCAGTTCTCT
GCGCTGCACGCGCGCATGCCTGCGAAGCTGGATGCACAGTTCACGCAGATCGTGGAGCGTGCCAAGACACGCGACGCCGA
GTTCCCGGCCAAGAGTCTGCTCCGGGCGTTCCAGAAGTTTGTGGACGACCACGTCGAGCGGGCAGACGCAGCCCTGCTGC
GCGACACGCTGGCCCCCCTGACCGATGTGCTGAACCTGTACATGGACGGGCAAAAGGTGCGGGAGCTGACGGTGATCTCG
TCGCTGTTGTCGATCTACGCAGATACAGAGCGTCTGTTCTCCGGGCGGCGGCTGCAGGACGAGGAGGTGATTCTAAAGCT
TCGGGACCAGCACAAGGACGACATACTCACGGTGGTGCAGACGGTGCTGTCTCACAGCCGGGTCAGCTCCAAGAACGGAC
TTGTGCTGGCCATCATCGACGAGTACCGGCCGAACAAGCCGAACGTGGGCAATGTGGGCAAGTACCTCCGGCCGGTGCTG
CGCAAGCTGACGGAGCTCGAGTCGCGGCAGACATCCAAGGTGTCGCTGAAGGCGCGCGAGATCCTGATCCAGTGTGCGCT
CCCATCTCTGGAGGAGCGGCGGTCGCAGATGGAGCTGATTCTGCGGTCGTCCGTGGTGGAGACGCAGTATGGCGAGTCGG
GCTGGGAGCATCGCGAGCCGAACCAGGACGTGATCAAGGACCTGGTGGACTCCAAGTTCAACGTGTTTGACGTGCTGCCA
ATGTTCTTTGCCAACGAGGACACGTGGGTGTCGATTGCGGCGCTAGAGGTCTACATCCGGCGGTCGTACCGCGCATACAT
TCTCAAGAAGATCGAGTATCACAGCGACGAGTCGGAGGCACCGCTCTTCATGACCTGGGACTTTGCGCTGCGGAAGATTG
GCCAGTCCGAGTTTGGCCTGCCGCTGCACTCGGCCGTGCCGTCGTCGCCGGCGACGCCAGCCACTCCGACCGACTATGGG
TTCAAGCGCATCAGCTCGATCAGCGACATGTCGTACCTCTCGCGCCAGACGCAGGAGGAGCCGACACGCAGGGGTGTCAT
CGTGCCGTGTCGGTACTTGGACGACGTGGAGGAGCTTCTCTCCAAAGCGCTGGATACACTGCCGTTTGGCGGCTCGAGGC
TTCGCAAGCGGAGCCCAGGCGCCGGTAGCTCCAGCACGCTGGCGTCCGGACTGGTGGGCAAGCGGCGGCCAGTTCCAGCT
CGTGTAGACACGGGGGTGGATGAGCTCTCGGCCGTGGTCAACGTGGCGATCCGAGACTCGGAGAACATGGACGACCAGGA
GGCACTCAAGGTGATCAAGCCGATTGTGGAGCAGTTCAAGGACGAGCTGTTTTCCCGTCGGGTTCGGCGAATCACCTTTA
TCGGCGGCCACAAGGACGGGTCGAACCCGGGTTACTACACGTTCCGGGGGCCCGACTACGAGGAGGACGACAGCATTCGC
CACAGCGAGCCCGCGCTTGCATTCCAGCTCGAGCTCGCACGTCTGGCCAAGTTCAAGATCCGGCCAGTGTTTACGGAGAA
CAAGAGCATCCACGTGTATGAGGCCATCGGCAAGGGCGTGGAGACGGACAAGCGGTACTTTACGCGGGTGGTAATCCGTC
CCGGCCGAGTTCGCGACGAGATCCCGACGGCCGAGTACCTGGTCTCGGAGGCAGATCGGACAGTCAACGACATTTTTGAT
GCGCTCGAGATCATCGGCAACAACAACTCCGATCTCAACCACATGTTCCTCAACTTCACGCCCGTGTTCCCGCTGCTGCC
GGAGCAGGTGGAGCAGACTCTGCAGGGCTTCCTGGACCGATTTGGACCGCGTGGCTGGCGGCTTCGGGTGGCACAGGTGG
AGATCCGGATCATCTGCACGGACCCGGAGACAGGGATGCCGTATCCGCTGCGCGTGCTGATCACGAACACGTCGGGCTAC
GTGATCCAGGTGGAGATGTACGCGGAGCGCAAGTCGGAGAAGGGCGAGTGGCTCTTCTACTCGATCGGCGGAACGACCAA
GATGGGCTCGATGCACCTGCTGCCGGTGTCGATCCCATACCCGACGAAGAACTGGCTGCAACCGAAGCGGTACAAGGCCC
ATCTGATGGGCACGCAGTACGTGTACGACTTCCCGGAGGTGTTCCGCCAGGCCTTCCAGAACAGCTGGGTCAAAGTGGTC
AAGCACAACCCAGCCCTGGGCGAGAGGCAGCCGGCAGCCGGTGAGTGCATCGACCTGTCGGAGCTGGTGCTGGACGACCA
CGACAACCTGACGGAGGTATCGCGCGATCCGGGCCTGAACACGTGCGGCATGGTGGGCTGGATCATCACGGCGCGCACGC
CCGAGTACGCCAAGGGCCGGCAGTTCATCATCGTGGCCAACGACATCACGTACAGCATCGGGTCGTTTGGGCCAAAGGAG
GACAACTTCTTCAACAAGTGCACGGAGCTGGCGCGCAAGCTGGGAATTCCGCGCATCTACCTGTCGGCGAACTCGGGTGC
GCGTCTGGGCCTGGCCAACGAGCTGATGCCGTACTTCAAGGTTGCGTGGAACGACGCGACTCGGCAGCACCAGGGCTTCA
AGTACCTCTATCTCGACGACGCGGCGAAGAAGCAGTTTGGCGAGCACGTGATCACGGAGGAGGTGACGGAAGATGGCGAG
AAGCGCAACAAGATTGTGACGATCATCGGGGCCGAAGACGGTCTGGGCGTCGAATGTCTGCGCGGCTCCGGTTTGATTGC
CGGCGCGACGAGCCGAGCGTACAACGACATCTTTACGGTGACGCTGGTGACGTGCCGTTCTGTTGGTGAGTGTTTGATTT
CTTTCGATTTGTTTTTCACGGTCAACTGACAAGCCAGGTATCGGTGCCTATCTCGTCCGTCTGGGACAGCGGGCAGTGCA
GGTAGAAGGCCAGCCGATCATCCTGACGGGTGCGCCGGCGCTCAACAACCTGCTGGGTCGCGAGGTGTACACGTCGAACC
TGCAGCTTGGCGGCACGCAGATCATGTACCGCAACGGCGTGACACACATGACGGCCAGAGACGACATGGAGGGCGTGTCG
CGGATCGTCGAGTGGATGTCGTACGTGCCGGACAAGCGAAACAACCCGGTCCCGATCAGCATCTCGACCGATTCGTGGAA
TCGCGACGTAACCTACACGCCGCCACAGAAACAGCCGTACGACGTGCGGTGGATGATTGCGGGCCGGCAGGAGGGAGACG
ACTACCAGCCGGGTCTGTTCGACAAAGACTCGTTTGTCGAGACGCTCGGTGGCTGGGCGCGCACCGTGGTGGTTGGCCGG
GCACGTCTGGGCGGCATTCCGATGGGCGTGATCGGCGTGGAGACACGAGCAGTGGAGAACACCACGCCAGCCGATCCAGC
CAACCCAGACTCGATGGAGCAGGTAACGAACGAGGCGGGTGGAGTGTGGTACCCCAACTCGGCCTTTAAGACGGCGCAGG
CGATCAACGACTTCAACTACGGCGAGCAGCTGCCGCTGATGATTCTGGCCAATTGGCGCGGCTTCTCGGGCGGCCAGCGC
GACATGTACAACGAGGTTCTCAAGTACGGCAGCTTCATCGTGGACGCGCTCGTCAAGTTCGAGCAGCCCATCTTTGTGTA
CATTCCGCCGTTTGGCGAGCTGCGTGGCGGCTCGTGGGTCGTGGTCGACCCGACGATCAACCCGACCGCGATGGAGATGT
ACGCAGACGAAGAAGCGCGTGGTGGCGTTTTGGAACCGGACGGCATGATTGGCATCAAGTATCGCAAGGATAAGCAGCTG
GAAACGATGGCACGGCTGGACGCCCGGTACGGCGAGCTGCGCAAGCAGCTTGCGGCAGCACAGAAGAGCGGCGCCACGAC
CGAAGTGCTGGACGGCCTGCGGGACCAGCTAACGGCACGTGAGCAAGAGCTGCTGCCGATTTACCAGCAGATTGCGACGC
AGTTTGCCGACCTGCACGATCACGCCGGCCGCATGAAGGCCAAGGGTGTCGTGCGCGACGTGCTGCAGTGGTCGAACGCA
CGGCGTTTCTTCTACTGGCGGGCGCGTCGTCGGCTGAACGAGGAGTACATCCTGCGCAAGATGGCCACAGTGGCCGGCGG
CAGTGTTCTCTCGGTCAGCCGGACAGGCAGCAGCGGCAGCAGCAGCAGCCCGGCGGCGAAGCTGCGGGCACGCCACCTGC
ACTTGCTGGCGTCGTGGTCGGCCGTGGCGGACTTTGACAAGGCCGACCGCGAGGTGGCCCTGTGGTACGAGGAGCACAAG
AAAACGATCCAAGAGAAGCTGGAGGCCCTCAAGGCCGACACGGTTGCGGCCGATATCCGCGAGCTGATCCGCGCGAACAA
GAAGGACGAGGTGGCCTGGAAGGGCGTGCGCGAGGTGATGCGCGTCATGCCGGTCGAGGAGAAGGAAAAGCTGCTGAAGT
TCCTGTCGGATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62