GenePrediction:GLEAN_131 Details

Name: GLEAN_131
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:889225..894901 (+ strand)
Length: 5677
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:889225..889439 (+ strand)
Length: 215
Type: CDS
Source: GLEAN
Position: GCSC_179:889507..894901 (+ strand)
Length: 5395
>GLEAN_131 class=GenePrediction position=GCSC_179:889225..894901 (+ strand)
ATGGCCACGCCGTCCACTGAGGAGAGAGAGCTCGCGCTCGTCGACAAGGTCGACTTCCGGATCCTCAACGTTGCCAACAA
TGAGAAGAAGCTTCAGGATCTGCTGTCAAAGTTTCTCGTCCCGCTTCTTCTCAAAGGTGCCAGTGAGCATGCGTCTGTTA
GGGCCAAAGTAGCCACAGTGGCCCAGCGCTTGAAGTTGTTCATCGCACCGCCAGGGTATGGCTGAATTGAGCTCTGCCTT
TTGTTTCTTTGTCCATGTGCCAGTCTAACAGCACTGTAACAGCATCGTTCTGCCGGTTGCTGCCCTCGTGCAGCAGTTCA
AGATCACGGACTCTGCAGTTGTGAGACATCTCGATATTGTGTTCATCCAGCACAGCATTGGCCGACTGTCCGACAAAGAG
CGTCGTGAGGTCATACCGATTATCCTTAAGGGCATAGCCAACGTAAACTCCAGCACGCCGGCACTGTTTGGGATTCTACT
GCAGGCGCTTCCCTCGTTGAAGATCCCCCCTCGGGGTTCGACCGAGGATGCGGCCTTTCAGGAGGCCATGGGCCTTACAG
ACCCAGCAGACGCGGCCTATGTCGCGGACCGGTTCGGCGACCTCTTCCTCCTATCTCGTTCCCACGGTGCCCTCTCGAAC
GGGCGAGACAGCGGCTACGTGGACTTTTTCTCCTTTGAGCAGCCCGACTCGTGGTTGTGCACTGGTCCCAATTTGGCGGA
GACGCGAATCCGGGCGGTTGGCTTTCTCGTTAGCGGTGCCTTTACCGACGAGCAGAGATATATGGCATCTCTGTATGCCT
CCGGCCACAAGGACAGCCGTGTCTCGACTATAGGCGAAGAGCTTCTGAAGCGGAGCACTGTCTCTCTGGAGAACAAGGAT
ATTGTGGCCAAGCTCTTCAAGGCCCATTCTCTAGCCCCCATGTCCTATCGCATCCGAATCTTGAATCTACTCTGCAAATC
GGCCATCGCGGCCTCTTCTCCAGCTGAAATTTTGGTGCTGGTCAAGCGGGACTTGAGGGCGACGAGCGCCGATGCTGATT
CGTATGACAGAGAGATTAGGACTTCCGAGGGAGGATTGATCCTCATGAGGCTATACACGCTCATCGTCTCCGGGGGCCTG
GAACTCTCGAAGCTCCACCGGGCATTGTTTGAGTTTATCAACTGGGTTGCGCGCATGAACTCGGGCAAGGAGTTTGTTAT
TGGCCGGCACCTCATCGCATGTTTGCAGAGCTACATCACTAGTCAGGGTTGGCCCAGTCCGGAGCAGGAGCTGAAGTCGA
TGGAGAAACTGCGGGCTCAGGCGTATGAGACCATTGGCATGTTGACAAAGGGCGCGCTACTGAATTTTGACGAGCAGCTC
GCCCTCGCCGCATGGCTCTTCCGCTCACTGAGCGAGGACTCTGTGAACTCTGTTGTTGTCAATATTGACGGTGCGCTTTC
GAGCATGACGTCCATATTTTGGCCCAAAGGCAAGGGGCCTGACCGTGAAGATGACGATATCAAGCTCCGAAAGCTCCTAC
TCAAGTACATCTACCAGTCTGATCACGAACCCTTCGTGCGACGAAGCGCGAGGCACGCGGCAGCAAAGTGGGCAAACAAC
TGCTTGCCTTTCTCCGACCCTTTTGCCAGGTGGATCGACATTCTTGCTGCTGCGGGATGTCCGGGAGAACGCAGTGATGT
GGTCGAAGAGGGCCTGAAAGGACTGGATCCATGGACCTATTACAGCAACGATGCAGGTTCTCTGGTGTTGCCGAAGTGGG
AAGAACTGGTGCATACGTTCTTCATAGTGTCTCCGGAATCTCTCAACGAGCACGAGGTGATCTACATGAGCAGCATGGAG
GTCGGCGGATCGCCGTTCGAGAAGTTCTCTCTTGAGAAAATGGGTGCCTTCCCGCTGGCGGTCGACTACTGCAAGCGAAT
ACTATTTCTAACGGCCCTGCCGGATTTCAAAGTAGGGCCCGGCTGGGAACAGCAAATCGGTACGCTCGTCCGCACGGACA
AAAAGAGCCGGGACACGATTCGGAAATACTTGAAAAGCGCCCCAGAGCAGAGACTGTTCGAACTCCTGTACGTGGCCCTC
GAAGGCATGATACAGGAGAAGCCGGCCATTGCAGAGAAGTGTGGAGAGTGCTTCGTCGAGCTGGCCTCGCTGTCTCCTCG
CGACTGCGTTTCCAGCTTGGCCGGACGGGCTATTGAGCTGATGGCGCTGGTCAAATCGAACAAGAAAGAAATCCGCAGTC
TAGGCGCGACAGCGATCGGCATTCTCGGAGCCCATCCAGCAAACGACGACGATAGCTTAGAGAAGCTGAAGGCGACTCTT
GTGGACACTGCTCGGCAGTGGAGAACTGCGGTCGGATCGGAGCTGAATGCCACGGAGGGTGCATTTTTGGCTCTGGGCCA
TCTTCTGTCACGGCTAGTGCTCTACGATAGCGACCGGGCAAAGCGCTTTGTGCTTGACGCCTCTTCACTCTTCCCCAGGC
CAGCGGAGATATCGAGTGGCTCAGAGTCTTTCAAGGACAGTCTTTTCGACGCCCTCAGCCAGATGTGGACGGCAGGTATA
TACGGGAACAGTGCAGCGGACACGGCAGCATTTGTTGATGTTATGAGCACGCAGGCAAAGAAGGCGAACGAGCGTTGCAT
CACGGCACTAGGACGGCTGGCGATTGCTGTTGGAAGCGATGTGGCGTCTGAGGAGAAGGATACAGAGACAGAGACAGAGG
ATGACACGACGCAGTTGATTCTTGGCAAGCTCTATGATCTGTACGAGGTCAAGCAGGTGGAGGTGCACTTTGCGATTGGC
GGTGCCATCACAGCGGCGGTGGCCTGTTGGGACTCTGAAGTGGTAGAGCTGTCACTGGACGTGGAGGAGGGCGAGGATGT
GTCGTTCAAGAGGCACAAGCGGCCAGTCAGACTCGCGGCGGCGCTGGACAAAATTCTGAAAGACAGCAAGACGACAAAGC
CGTCTCTGCTAAAAGCGTCGGGGATCTGGCTGTTCAGCCTGATTCAGAACTGCTCGCACCTGGCGGAGGTGCAGTTGCGG
CTGCGAGATTGCCAGACAGCCTTTATGAGGCTGCTCAGTGCGCGGGATGAGCTGGTGCAAGAGACAGCATCTCGCGGGCT
CGCGCTAGTGTACGAGAAGGGAGACGAGTCGCTCAAGGGCGACCTTGTGCGAGATCTGGTGGCGTCGTTTACGGGATCGA
GCACGCAGCTCAAGGTGGACGACGACACGGAGCTGTTTGAGGCCGGAGCTCTGCCGACGGGCGAGGGCAAGTCGGTCACC
TCGTACCGTGATATTGTCAACCTGGCCAACGAGGTGGGCGACCAGACGCTCATATATAAGTTTATGTCGCTGGCGTCCAA
CGCGGCCACATGGTCGACGCGGTCAGCGTTTGGACGGTTCGGGCTCAGCAACATCCTATCCGAGTCGGAAGTAGACCCGA
AGTTGTATCCGAAGCTGTTCCGGTACCGATTCGACCCGAACCCAAATGTGCAGCGGTCGATGAACGACATCTGGAAGGCA
CTGGTGAAGGACTCGAGCGCGGTGATCGAGGCGCACTTTGGGGCGATCATGGAGGACCTGCTGAAGAGCATTCTGGGCAA
AGAGTGGCGGGTGCGAGAGGCGAGCTGCGCGGCGGTGGCAGACCTGGTGCAAGGGCGGCCATTTGTGCAGTACGAGAAGT
ACTACGAGGAGATCTGGGCGAAGGCACTCAAGGTGCTGGACGATGTCAAGGGATCGGTGCGTGAGGCGGCGCTGCGGCTG
TGCATCACTCTGTCGAACACGCTGGTGCGTCAGCTGGAAGAGGGGAAGCAGGGCGGCAATGCACAGGCAATGATGAACGA
GGCGCTGCCATTCCTGATGTCGGAGAAGGGGATCGAGAGCGGGGTGGAGGACGTGAAGATCTTTGCGACAGTGACGGTGC
TGAAGATTGCGAAACACGGCGGAAAAGCACTGCGGCCGTACATTGCGGCGATGGTGCCGCACTTGCTGGGACTTCTGAGC
ACGATCGAGCCGCAGGCATTCAACTACTATTACATGCGGTCGGGCGAGGACGGCAAGGAGAAGCTAGACAAGATGCGCAG
CGCGATGGTGTCACAGTCGCCCATCTCGGAGGCAATCGACAACTGTCTGCGCAACGTGGATGGCAGCGTGATGGAAGAGC
TGGCACCGGGCCTGGAGACAGCGATGAAGACGGCGGTGGGGATGCCGACGAAGATCGGGTGCAGCCGGGTGCTGTCGACG
CTGGCGACACGACACACAACCGAGTTTGGGCCGTTTGCCGGCCGACTGCTGCGACAGCTGGAAAAGCAGGCGCTGGACCG
GAACGACGAGGTCAGCCAGAGCTACGCCAAGGCGGCGGCGTACGTGATGCGTTGCGCGCCCGACGAGGCGCGAGTGCACT
TTGTGGAGCGGTTTATCGAGCTGTACTTTGGATCGGAGGACGAACATCGACGGCAGAAGGTGGCGGACGCAGTTTTGGCG
CTGTCAAAGATGTCGCCGGACCACTTCAACGCGCTGGAGGGGCGGCTGCTGCCGTTTGCATACGTGAGCAGCCATGACCC
AGACGACTACGTGCGCAAGGCGAGCGAGGAGGTGTGGAGCAAGCACGCGGGCAGCAGCCTGAGCGTGGCGCGATACGTGC
CGGAGATCGCAGAGCTGGTGCGGCGCAGCCTGGAGACGGCGCAGTGGGCACTGAAGCACGCGGGTGCGCTGACGGCAGCA
GACGCGGTGAAGGCGGTGCTGGGGGCGAGCAGCCTGAGCGGACAGGTCAACGAGGGACATCTGCGACAGCTGTGGCCGCT
GTACGAACGCGGGCTGGCGCTTAAGACGTTTGCCGGCAAGGAGGCTCTGCTGGCAGCTCTGCCCGACTTTGTGGCCAAGA
GCCGGGCGCTTTGGATGGCGGACAGCAAGATGGCGGCGGCCCTGCGCAAGATCGTGCTGGTGGAGGCGAAGCGCAACAAT
GCCGAGTACCGGGTGGACGCGTTCCAGTGTCTGTGGAAAGTGGCGGCAGAGCGGAAGGACATCGACCTGTGGCCGGAAGC
GGTGGCAATTGTGCGGCCACATCTGGAGGCGCTGCTGGAGGAGGACACCGGCAAGAAGGATCGCATGGATCTGGACAGCG
GCAAGGATGGGGACAGCAAGAAGAAGGAGGCCGCGAAGCAGGAGCAACTGGTGCGGCAGACGGCCGAGAGAGCGCTCGAT
GTGGTCGCCCGCAGCTACAACCGTCCAGGACTCGAGGCAGACGCGCCGGCCATCCTGACAGCCATCTGGACGGAGCTGGA
GCCGTTCCTGAACAGCGACGCGTCGGTGATCGTGCGACGGACGACGTGGTACAAGGCAGCCGAAGATTTGTTTGAGGGAG
CGGTGAAAGCGACAGAGAAGGCGATAGAAGCAGGGAAGCCAGCCAACAACACATCCGCTATGAATCTCATCCTTGCCTAC
CTTGGATCGCTCGACCTGCGCACGGCTGACGCTGGCACGGAGGCGCAGCGGTCGGCGCGGGCAAAAGCCGTCAAGGCGCT
CGTGCAGGCGGCCAAAAAGGGCGTATTTGGGCCGTCTGGAACAGATGAGGCGCTGGTCAATGCGCTGGCCGAGATCAAGA
CGGTCCTGACAGCAGCACTGGCGTCGGAACGGGCGCTAGATGTGCAGAAGCTGCTGAAGGAAGCGTTGACAGTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62