GenePrediction:GLEAN_132 Details

Name: GLEAN_132
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:895478..897187 (+ strand)
Length: 1710
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:895478..895603 (+ strand)
Length: 126
Type: CDS
Source: GLEAN
Position: GCSC_179:895868..896107 (+ strand)
Length: 240
Type: CDS
Source: GLEAN
Position: GCSC_179:896207..897187 (+ strand)
Length: 981
>GLEAN_132 class=GenePrediction position=GCSC_179:895478..897187 (+ strand)
ATGGACGACGAGCTGGCGGCCAACTTTATGGCCGTGACAGGGGCCGACGAGAACATTGCTCGCCAGCTGCTGGACATGGC
CAACGGCGATCTACCCCAGGCCGTGCTGCTCTACTACGAGACGGACGTGGCCGAGACGCTACGGCGCCAAGCAGCCGAGT
CGGCCTCGGCCTCGGCAATTACGACGACAACGGGCAGAAGCGCACGCCCAAGCCGGCGAGGCGGCCACGAAGACGAGAAT
GGCGTAATCCACATTGACAGCGACGACGAAGCAGACGGCGGCTACGACTACGAGGAGATGGACACGAACGACGACGATGG
CGACGAGAACGAGAGCGAGAGCGACCGGCACGGCGCCCATATGGCACGGGCGGTGGCGCGGACAGCCCAGGAAGAAGAGG
ACGAGGCGATGGCGAAACGGCTGCAGGAAGAGATGTACGCGGAGACGGCGACGACGTCAGACGGGATCCGGGCGCCGATT
GCGCGGACGACGGAAGTGCTGGTGGAGCCGTCGTACGGCGGGATCGGTGGCGGTGTCGGTGATGGCTTTGGCGGCGGAGC
CGATGCGATTTACGAGCAGCTTCGACGACGACAGCAGCGACAGCCAGCACCGGCCAATCCGTTCAGCCAGGTCTGGGACG
ACGACGGGACAGGGGGGCTAGCAGCGGGCGGCAGTGGGGACGAGACGGCACAGCAGCAGCAGCAGCAGCAGCAGCCAAGC
TCACGACAGGCGCGACTGGCCGACCTCTTCCGGCCGCCATACGATCTGATGGAGCGGTGCTCGTGGGAGGAGGCACGGGC
GATGGGCAAGGCCGAGAAGCGGTGGATCCTGGCGAACCTGCAGGACATGTCGGACTTTCTCTGCCAGGCACTGAACCGCG
ACATCTGGAAAGACCGGGCGATCCGCGAGCTTGTGCGCGAGAATTTTGTCTTTCTGCAGTTTAGCCGGGAAGACCCAGAG
GCGCAGTCGTACGTGCAGTACTATCTGCCGGGTGGCCAGGACGAAAACCCGGACAACTACCCGCACGTAGCGATCGTGGA
CCCACGCACGGGCGAGCAGGTCAAGGTCTGGTCCGAGCGGCCGTTTCCAAGTGCAGCCTCGTTCCACGCCCAGCTGGCCG
AGTTTCTCGACCGTTACAGCCTTGACTCGACGCGCAAGAACCCGGTGCAGACGGGCAAGGCGCGGCAGCCGGCGCGGGAC
GTTGAACGCATGACTGAGGAGGAGATGCTGGAGATGGCGCTGCAGAACAGCCTGGAGACGAGCGGAAGTGGGAGTGCAGG
TGGAGGTGGGGGTGGAGTTGGAGTTGGCAGTGGGACGGAATCACGGCCGAGCCTACAAGACCCAGACGAGCTGACCAAGG
GAGAGACGGAGACAGAAGAGACGGAAGAGACGGAAGAGGTTTCGGAATCCTCGGCTGCTTTTGCACGAATCGCGTCCGAC
CGTCCACACGAGGAGCCGGCCAACGGTCCGTCGACGACACGGATCCAGTTCCGCCACCCAACCGGACGGGTGATCCGGCG
ATTCGCCGCCGACGATCGCGTGCTACGCATCTACGAATGGCTCAAGGCCGAGCCGCTCGAGGGCAAAGACGGGCTCGAGT
TTGAGCTCAAGGTGGTGCCGCAAGGCCACGACTTGCTGGAGGACCTGGACAAGACAATTGAGGAGGCCGGCCTGAAGCAG
GCGACGGTGATGATTGAGTTTATCGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62