GenePrediction:GLEAN_1331 Details

Name: GLEAN_1331
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2138194..2139040 (+ strand)
Length: 847
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2138194..2138332 (+ strand)
Length: 139
Type: CDS
Source: GLEAN
Position: GCSC_173:2138412..2139040 (+ strand)
Length: 629
>GLEAN_1331 class=GenePrediction position=GCSC_173:2138194..2139040 (+ strand)
ATGATTGCTGCTCTCCGATCTGGGGATATTGACGTGGGAATAGGCCTCACTGAAGCTTGGATTGCTGGTCTAGGGAATCC
CAATGTCGAAGGCGACGGCGGCTACCGCATTGTCGGGACATATGTGGAGACACCCCTTTGTTCGTGGCTCCTTTTTTTAA
CGAGCGTCCAACTTCAACCTGGTTGTATCTATTGCTGACTGCATTGGTTTATAACTAGGCTGGGCTGTTTCGACGGGATA
TGACCGTGCCGACATAACTTCCGTCACCTCTCTACATGGGAAAAAAATCGGTGTTTCTCGCATGGGCTCAGGAAGCTTCG
TCATGGGCACCGTGCTCGCCGATAAACAGGGTTGGCTGAATGGCTCCAACAGCGAGCCATTTTCTGACACAGTCGTACTC
AACACGTTTGAAAACCTGAGAAATGCCGTGAACTCGGGAAGTGCCGACTTCTTCATGTGGGAGCATTTCACGTCCAAGAA
ATACTATGACAGCAATGAAATTAGAAAGATTGGCGAGATCTACACCCCATGGAGCAGCTGGAAAATTGTTGCTTCAACTC
CTCTTGTCGCCAACGGTGTTATTGACTCCCGCCTAGAGGATTTCTTTTCGAAGCTCGATGCCGGCATTTCTTACTTCATA
ACAAATCCAGAGGAAGCTGTGCATTACATCAGCACATCGCTCGACTACTCCGAGGAGGATGCTCGGGCATGGTTAAAAAC
GGTCAGGTTTCCAACAGCAACCCGCGGCGTGAACTTGAAAACTGTCGATGGATGCATTGAAGTTCTTCGAAAAGCTGGCG
TTCTTGTAAATAATAAAGGTTTTGATGCAAGTGCCATGCTGGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62