GenePrediction:GLEAN_1332 Details

Name: GLEAN_1332
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2147140..2147751 (+ strand)
Length: 612
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2147140..2147253 (+ strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_173:2147319..2147435 (+ strand)
Length: 117
Type: CDS
Source: GLEAN
Position: GCSC_173:2147533..2147751 (+ strand)
Length: 219
>GLEAN_1332 class=GenePrediction position=GCSC_173:2147140..2147751 (+ strand)
ATGCCGACCCGGTTTACGAAGACACGCAAGCACCGCGGCCACGTCAGTGCCGGTAAGGGTCGCGTTGGAAAGCACAGGAA
GCATCCGGGTGGTCGTGGTATGGCCGGTGGTATGGTATGTATCAATCACAATTCGATCAACTCGAAGGCCGGCATAACTG
ACACGGTCCATTACACCAGCACCACCACCGCACGAACCTCGACAAATACCATCCCGGTTACTTCGGTAAGGTGGGCATGC
GCCGATTCCACCTGCTGAGAAATCACCAATGGAACCCGGTCATCAACTTGGACAAGGTACGTTTGACAGCATGCATGAGC
AATATTCAACAGCCATCATATTCTAGCACCACCACTGCCCCATCGAGACTGGTTTTCCTGACACTTTACCTAGCTCTGGA
CGCTTGTTCCTGCTGAGGTCCGTGAGAAGTACCTGTCTGGCGAGAAGAAGGACACCGCCCCCGTCATCGACCTGCTCCCT
TTCGGCTACTCGAAGCTCCTCGGAAAGGGCCGTCTCCCCGAGATACCACTGGTTGTTCGCGCTCGCTACGTCAGCAAGCT
TGCCGAGCGCAAGCTGAAGGAGGCCGGTGCTGTTGTTGAGTTGGTCGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62