GenePrediction:GLEAN_1334 Details

Name: GLEAN_1334
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2157924..2158887 (+ strand)
Length: 964
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2157924..2157971 (+ strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_173:2158198..2158887 (+ strand)
Length: 690
>GLEAN_1334 class=GenePrediction position=GCSC_173:2157924..2158887 (+ strand)
ATGTCAACGGGCAAGATGGCGTCAAATGGTCGGTGCCTCGCCTTTTTTGTAAACCCGACAATCTTGACTTCAACACGGCC
CCATGGCAGTTCCATCCCGAAGCTATTCATTTCCTACGCCTTTCAAACGCGCCAAGCCTCAAAAAAATCTGAGAAGAAGA
AGACAAAGCACAAGGCTTTCCGAGTCCACGAAAAAACAAAGCTCGTCCAGTACTCCTTGTGTGATGCTATCAGGTGGGCT
CAATACGTTTCTCTAACTGGGATACCAAATACAGAGGCTGATCGTATGGTGGTGCTTCAGATATCTTCGCGCCGTGGAAG
TTGGCCGCCCGCCTGCCAGTGTGACTTACGATGTTGCACTAAAACTACAAACGAACAAAGACGGCGCCGTCCTGCGTGAT
CGCATCAGGCTACCACACCCCTGTAACTCCGACTTTCGTATTGCCGTTGTTTGCAAAGAAGGAAGCAAGGTCGCAGCGGA
AGCGCGAGCAGATGGCGCAGTAGCTGTGGGCGAGGAGACGCTCATTGCTACGATTAAGGCTGGAGAAATCAATTTCAACC
GTCTCATTTGCCACATTGACTCCGCGCCGGTACTTATGAAAGCCGGTCTGGGCCCCATATTGGGGCCTCACGGCCTCATG
CCGAACATCAAGAACAAGACGATCACAAATGATGTTCGCTCTCAGATGCGCGAGATGGCAGGCACCGAAAATTACCGAGA
ACGTGCCGGCGTGGTGCGCATGGCAATAGGCCAGTTGGGATTCACACCACAGATGATCGCAGACAACATCAAGGCGTTCA
TGGCCAAGATCAAAGAGGATATGCGCAAGGTTGAGCTCACGACACCCAAGACTGTCGACGAGGTAGTTCTAAGCACTACG
AATGGTCCTGGAATCAGCCTCAGTGGGGGTTTCAACCCAACAGACGAAAAGTTAACACCTGCTCACCTTTCCACAGCGAT
GTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62