GenePrediction:GLEAN_1336 Details

Name: GLEAN_1336
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2165665..2172460 (+ strand)
Length: 6796
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2165665..2165893 (+ strand)
Length: 229
Type: CDS
Source: GLEAN
Position: GCSC_173:2166555..2172460 (+ strand)
Length: 5906
>GLEAN_1336 class=GenePrediction position=GCSC_173:2165665..2172460 (+ strand)
ATGCGATTGGTGGGGCCGTGCTTGTGCCAGCAGAGCAGCACTGCCCTGCCTGCTGGCAAACTTGGGCAGGTCTGGGGGAC
CGGAGGCCTGACGGCCTGGAGGCCTAGAGGCCTGGAGGCCTGGGGGCCAGGAAAGACCTGGCAGGCCTGGCAGGCCTCGA
CGGGCCCGCTTCCCCTACTCCGTAGCCGCCAGGCCCTAAAAACGGCGCCGAAACTAGTGCACAACGACTGTAAGATACTC
ATACATGGTAGCGTGGCAAAGCAGCCCCAGCTGGCGCACGTTACAACGCTCCTTCCTAGCCAGCCGAAAATGCGGATGGC
ACTTGCCTGCCCAACACATCAGCTCCGAGTACTACAGCAAAACCTAGAATTCCTCACGATCACCTGTTTCGCTCTGTTTT
CGGGGGTCCCTCCCTATTCTATCGTTTGCCTCACTTTTGCCCTTGGCCCTTCGCTCCTCCACTACTAATTCGCCGCACCG
CCGCATTCTCCTGGCCCCCAATCCCCCTCCCCCCTCGATGGGGACGACCCGCCGCTGGAGACGACTACGCCAACGCCTAC
GACTGCGGACTATCCTCACGACCGACACTCCCGGGCCCTCTTCTCGAAGCTAGTCGCTAGATCATCAGGGGCAGCGCCGA
GCCAAAAGACACAGAGAGACGACGGTCAAACATGCGGATCTGAATGCGCCATTCTCTGCCGCCTTCTTTACCACCTCACT
CTTCCCGCCTTGAGGGCCCTCGGGACTCGTTATGGTCTTCATGGAACGATCCTCTTCGTCGCCTGTTTGTGTGCACTCCT
CGTCCGGTCCGTCTTCACGTGCTCCCTTTTCCTATACTATGCCCATCACCTGCAGCTGCACCGGTACTGACTTTCAATGC
TTTTGCACAGCTCCGCCGCCGGCCGTGATTGACGTCTACAGGCCGCCGACACCACCGCTCCAGCTCCCACCCAACAATGA
CGGACAATCGCGACTGTACCGTGTCCTACATAGCATCGAAAGCACCACAAGTGCCGGCAGCGCCGACGGCATGGATCGTG
GCACGTCTCTGCAGGCCCGTCACATTGACGGTACTGCTCGACGGCCATCCGCCCCTCCGCTTGCCGTGCCTCAAACCCTG
ACTGGGTTTATAATTCATGCCAAGACCAGTGCCGCTGTACCCACGACTGCTCCTATCACTGCTACGGCCACAACGACAAC
GACGACAACCACTACTACCACGGCCACGGCGAGCACCACTTCCTTGTCGCCAGGTGCTCCTCTCGGCACTGAAAGTAATG
ATCTGCCGCCCTTCGCTCCATCTGCTTCCGGACCACATCTGCCAATCTCGGAGCAGCCGCCCGTCTCCGAGCCTCAGTCG
CTGGAGCCGCCATCCTCGTCTCGCGAGGCCATGGAGCAGACATACTCGGAACCCACTCGCGGTGCAAGATTGTTGGCTAG
CTCTGCTGAAATACCCTCTGTGACTTATTCGTTTCCCTCAGCACCGCTGTTGCAGGATCCTTCGCTGTATGTCACTGGGC
ATCGAGAAGCCGAATCGGAGGGCACGTCACTAGACGAACTGGCCCATCTAGTGCGTCTGGCTAAGTACCAGGAGCGCAAA
CGTGCCCAGACGCGTCTGCGGCTCCAGCTGACCCTGATATCAACCGCTCTATCTGCCCGATTGGTGCGCTGTGGCGAGAT
GGCCCAACGCAACCTGGCTGAGTGCTTTCAAGCTGATGACAGGAGCGGGTTTGCTAACCTGTATAACGCTCTGCATAATG
TGCGCAAGAGCTGCGATGAGCTGCGCAAATACGCTCTTTTAGAGCCAGAAATTGACTCGTTCCGCTCGTCTGCATCAATC
GGAGGTGCAGGTCCCACTGGAGACTCTTTCGGTCCTGGCCGCTCTGGCCCCGGCTCTGCATCCATGTCGCATTTTCTCAA
TGATATTCCAGCCGATGCCAGCGATACGTTTATTAGCTTTCTTACCACGATCAGGAATAACCCGGACTATTTGGCCACTC
GGCTGTGCACCTTGACGGCATCCGAGCTGGCTGCATTGGCCAGATTTTATCAGGGAACGGAGCCTGTGGATTCTGTTCTG
CCATTTCACCATCGACATTCTTCTCTCCGCGGCGGTGCATCTGGCAAGCCCCAGGCTCATAGATATGCTGCTACTAACAC
AAGTGCACGGGACCCCGACTATGTGCAGAAGCTGCTCTCCTTCCAGAGACACGATCCCCTATCTGCCCTCCTTCACACCT
GCTTTGCAAATTCCGCTGGCCCTGACAGCACCGAGGACAAGCGCCGGACGAGCACATGGGCATCTGCCTGTGCACGCCTG
ATCTCCGAAAAGGGTGCGGCCGGAGAACCAGTTCTGACAGCGGTCATGAATGCCTGGTCCTCAATGCGTGGATGGGCCGG
CCGGTCTAATATGGAATGGTTTCTGATGAAAATACTACAAGACGGGGCCTTTCTTCTCGACCGCGCAGAAGACCAGAATG
GAACACGCTTCAATCTGTACGAGTGGACGTCGAAGGATCACATTGCTGCGGAGGAGTTTTACGACCGGGCTATAAATGAC
CTCTTCGATGTTATAGATGACGAGGATGCCACGGGTGTCCCTGAGGGGCTGATTGAGCTCGGAAACCAAATCCTTGGTAA
ACTTGATCCTCAGCTTGCTGACAGCACTCGCAACTGGTTTGTCTGCAAATGGCTGTTTGGTGTCTGGCTTCTCGGCGTCA
TCGTTCACCCAGAAACACATGGCCTCATGAATGAATACCATATTACCGAGTATGGACGGCAGAAGATTCTGAAGGAGGTG
GCGCTTCGCGCACAGAGTCTTCTTATCGAAAGGACCACGTCCATTGGCAACTCCAAAGCCGTCAACCTGGCCTCGACACA
CCCGACTATCAGAATTCACATTGAGAATATCATGAACAAGTTCCATGGTCTCAATACGCGCAGTCCTCCAACCAGGCTTC
TTCCCGCTCGGTCCATTACGTCCCTGCGAGAGACAGCCGAGGTTCATCCGTATCTCGTTTTGAGCCCGGCCGATCTCGTC
ACTCTCGTCAATGCCCTCTTCCCAGATCGCAGGCCCCGATCGGGCCAATCCAGCAGCAACCGGTCCGGACCTGGCTCCGT
TTCCGGATTTTCGTGCATGTCTCAGCCTGTTGTCACGAACTTGCAGAGGACGGGTACGGACAACTATACTTCTCTTAGCG
CCAGCGTCTCGTCCACGACCAGCGATGCTACTACGTCCGTGGAACCGCTTCTCGACGACCAGCGCCCCGGCATCTCGGCC
TCCCGTCTGTCACCGCCGTCGTCTGTACTCTCTGGGCAAGATCGACGGCCTTTGAATAGCTATGAAGATGACGGCTACCG
GTTACATCTAGCTGTGAATGAAATGGTGCACACCCTTGGCCGTGATGTCGTCGCCGGCTTTTGCCACCCCTGTGCTGAGC
GCTGGGCGGTCATATTCATCTCAGCCGATGGCAACCGGCTGTCACTGCAGACGACTTTTGACGGTGACGATGACCCTGAG
GAGGATGCTGCCTCTTCTTCAATAGAGACAGACGAGGACACAGATGATGCGGAGTCCGACCTGGAGATAGCTGAGCTTGA
CAAGGACTACCATCAGTTGCGCGACTCCATACTGAAGCTAGTAGAGGACTACGAAATCCCGCCTGGACTGGAGCTCGAAG
GAAGCCATGGATCTACATACAGCAACCGGGCCAACCGCCGGAAAAAGTACCGTTTGAAGAATAGCCAGGTGATTTTCCCC
GGAAGTGCGCCAAGATTGCAAAGCCGTAACCCATACTGGCGGCAAGCTGCACCACCGCAACCTCTACACAACGGTCCGCA
GTCTGCGCATAATGAGAATAGTGGCAAACCCTCCAAATCAGCATCGTCTGATGACATGGAGACGAGGCAGTCTGTTCTGA
TTGCAATGCTCACTGCTGCGTCGTCACAGTCTCGGGCCCAGTCTGACTTCCTGTCTGCGCATCTATATTGGAGAACGATT
CAGCAACTGAATTCCTTGACGGTGGAATCCCTGCGGCGCAATGGCTTTGCTGCGCTATTGAACATCTTCTCGCGAGGGCC
ACGCGACACCATTCGTAAATCCGATGCGGCCGTGGAGGAGTACGACGCCTGGCTCATATGGCTGAGACAGTCACAGGAGC
GGGTTGAAGGGCTGATCGAGACGATGATGAGACGTCTCCGGGCTCTGCGAGACAAGATGTGGTATGTCACCGATGTGCGC
AATTCGGGGCCTTACGAGTTTAGCCGCAATATTGCCGTGGCTTTGAAGACGATGGGCACGAGCCGAAAATGGGATGCATA
CAGACGGGTGCGACAGAGCCTGCCGCGGGGTCCAGCTGCTTCATACCTGTACCGTACCGAAAGCGAAATTGTGGAGCTTC
TGGCTGCTGTGGAGGAGGAAGGGGGGCCGAACAAGCTCTCGGACGACCAGGCAGAGAAGACGATTCGGTGGCTCGACCAG
TTCGGCATTGAGAATTTTTGTCGGGGCGAGGAGCGTATCCATCGGTTCTGTTGCGAAATCGGGAGCTGTGTGGACAAGCT
GATTGGTGGCAGTCTCATGGATGCTCCTGTGCTATGGGCGAGCGACCTCTACACTCGAGACCGACAGTATCTGGAGCGGA
ACAACCGGACACAACGCGACTGCGACGGCAACAGTAGCCTTGTCTGGGACGATGGGTCTAGTGTGATGAGCTTCGGCGAA
CTTGACAGCCGGCGTCACAGCCTATCTAGCCGATCCAGCTCGGCCGTGCGAGGCGATCCGAGGGCCAGACCGAGCCAACG
CAATCCCAGTCTACAGTCTTACGACTCTGGTCAGTACGGCTTTTCAAGGGCCAGCACATCGCTATCAGACATCCTGGACA
CCGAAGTGCAGTTCTCCGGACGCTCCATGTCGCCAGTGTCTGCTATTGACACCGCGACGACGTATTGGTCTCCTTTCCAA
GCGTCCATCTCGCCGAGCGTGGCAACCTCTCGCACACAGTCTCCAACCACAAGTGTCAGCAATCTTTCATCTTCGTTCTC
TCAACTGAACAGGCGGCCATACAACTTTGACCAGGGAAACCTGCATAGCCGCTCTTCCCATCATTCTGCCGGCCGTCCTG
GCTCATCGGTATCTTCGGTCGATACGGTCTTGCAACGACGCATCTCGGATGACAAGGCACTCTTTTTGGATGAGCTTCGC
CAGACACTGACCAGTCTCCTTCTCTCCGACTTGGGAACTTTGGTCTTTTCTCGGGGCTCCGAGACTGACGCTTGGTTCGA
GAACCTTGGACAGGAATGCATCAACCGACGCGAAACGATGGCAAAGAGACAGCGCCAGGAAAAGGACTCGGAACAGAAGC
CCAAGTCGACACGATACTCGCCAAAGCAAGTCGTAATTGACACATCTGGAATGGCTGCCCCCTTAACTAACTCGGGATCC
CTGGCTGGAAGCGACGGCAGCAGAAGCACAAGCAGCAACCACAGCAGCTACAGTCCATCAACCGATGATATGCGCGGACG
GCCAGCAGAGACACTGGGAACAGGCCAAGAAACAGAGAGCTTACAGACAAAAAACAGCCTGGCCAACTCGGCTTCTCGCA
CCAGAAGAGAAATGAAGGACTTTCCGTACACAAAGTCCTACCATCGTCTCTTGCGATTGTTCTGCGTACATCCAAACCCT
TATGCCAAACTGAGCGCCCTGCTGGAGCTCGAGAATCTTATTGTGGCTTCTCTGTCGTCCCGCAGCACCCGGCGACGGCT
GGCCCTTCTTACGCGATCAGGCTTACGACCCGTGATAAGCAGCAACAGCTCGCCAGCAGGGACGCAACCGGGAGAGGATC
CTGCCGTGACGCCTCCGATATCCCGTGCAAAGCCGCTGGAGGACACGATAGACAACGTGAAGGGGAGGCGTTCCAGTACG
TTCAGCCCGTCTCTCTTCTCGGCTTCGCCCATGTCTCCCCGCCGTGGAGGACCATATGGAGGTGCGGTCGAGTCGCGACC
GGGGATAGCTGCGAGCGGTTCAGCCAACAAAGACGCCATTCTGACGATTCTCGTGTCGCTTTTCCGAGAAGCGTCCATGC
GGCCGAAGACGCTATTTCGGGACCTCCAGTTCATCGCCTCGTTCGTCCCTCCCGACGTGTTGGATCAGACAGAGTCTGGA
AAGGCCTTTTGGAATGCCGGTCTGGCAGCCCTGCTGCTGAAGAAAGAAGTATGCAGCACCATGGTCGAGGTGGCCGACGA
GATTGTTGGCGTCTATACGAAGACGCGCAAGGGTTCTGCTTCTGCCTCGGGAGGGTCTGCCGACTCTTCCAAGGACGGCT
CTTCGACAAGCTCGCATGCGCGCAGTCCCACCATCTATTCCCTCGCAGATGCCGCCCGGATGTGGACGATCACGGCAAAA
GAGGGCGACCCGACGTCGCAGCGGGAACTAGCCATTTTCTATCTGTCCAACCCGGAGCTGGTCGAGCGGACGACTCTGCC
CCTGTCCAAGCCACATGAAGTGTTTAAGAAGGCTGTGATGGAAAAATATGGCGGCTCGGGCGGAGGCAGTCGGTATCATC
AACACCAGGCAAGCGGCATCTCGACCCGAGGCACGTCTTCGTCTGCCAGTGGCGGCAATCATGGAGCCTCTGGTGGAAGT
GGGTCAAGCGGCATCGCTGCGGGTGTGTCTGACGTGCGCAACGACCCTGCTCTAATGTGTGTTGCCATCCACTGGATGGA
AGCCGCCGAGCAGGGTGGCGATGAGCTCGCTCGTACATTCCTCAATCAAAGCAACGAGATGATGAAAACATCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62