GenePrediction:GLEAN_1337 Details

Name: GLEAN_1337
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2175837..2176866 (+ strand)
Length: 1030
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2175837..2175880 (+ strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_173:2175951..2176866 (+ strand)
Length: 916
>GLEAN_1337 class=GenePrediction position=GCSC_173:2175837..2176866 (+ strand)
ATGCCTTATGCTCTTCATACTCCCAACAGCGGCGAGACGGCCGTGTTTCCCTTCATGTTAGAAAATGTTTCCACGACATG
CGCAATCGTGTTACTGACAAGCTAATAACATCAGGTCCCTACCGACAGAAATCCGTATTATGATATATGAGAACCTGTTA
GTTGTACGAAAGGGAATTTACATCAAGGAGCTTCCGGGCATTTACCGTACCGGTGTTTTCCAGTGCCACCCGGCGCTGTG
CAAGCGAGATTGGTCTCTAGCAAATGTCCAACCACGAAAGAGACATGCAAGATTCAGGCCACCGACACTAGAAAGCTTGT
CCAAGTTTGTTATACAAGAAAAGCTCGGCATCACGGCTCAGAGCGAAACAGGGCCAATCAAAAACGTCGCTGGAATGCGC
AAAATGCTTATGATACTGAAAAACGAGCAAGGCCCGGGCATACAATATAAGATCTGGTTAAGTATCTTGGCAATGTGTAA
AGACGTATATGCCGAGGCGGTACACTTTGTCTACAGACAGAGATTCACATTCGCCGATACTGGCACTCTACACAACTTTG
TCATGTTGCTGGGACCAGCAGCACGAGAAATCCTGGGTGACATTCAGATTTTGGGCTGGGAGGATAAACGGTCTATAACA
AGTGGGCCAATTCCTGCCTTTTCAGTGTTGAAAGACGTGGTGAACTTGAGGAGACTTCACGTTTGCTGTTCGATCGGAGT
GCCCCAAGACTGGGCCTGGGTCAACGTCTTCCCGCCGCGGAAAACGGAGCCGATACCCAGATACCACCATCCTACAGACA
TGATTGCAAGCAAGATTTACCGTGACTGCGCCCACTGGCTGAGGCCTATGTTTATTCAAAGTGGCATGCACGAGATCAAG
CAGGTTCTCCGCCTGGACAAGAGAAACTTCATGCCAGTTCTGCGAACCTCGCAAAATCCCCTTCCCGCATTCACCAGAGA
GATGTATCAGGAAATGAAGACTCGCTTCTGGGCATACCTGGAGATTCTTTTGGCCGGGAATGTGATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62