GenePrediction:GLEAN_1339 Details

Name: GLEAN_1339
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2186006..2186740 (+ strand)
Length: 735
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2186006..2186023 (+ strand)
Length: 18
Type: CDS
Source: GLEAN
Position: GCSC_173:2186140..2186660 (+ strand)
Length: 521
Type: CDS
Source: GLEAN
Position: GCSC_173:2186731..2186740 (+ strand)
Length: 10
>GLEAN_1339 class=GenePrediction position=GCSC_173:2186006..2186740 (+ strand)
ATGTCTGGAGAGAATCGTGTACGTAGTCCCCTTCGTGTGCCTTGAGTCTGCCCCTCTGGCATTCGTGATTGATCTGAGCG
AATCAAGGTACGAGATGTAGCAGTTCCACTGACTTGCCGATGGCGCGCTCACAGGAAGAGACCGGACTGCCGCCCAACTG
GGAGGTTCGTCACAGCAACAGCAAGAACCTACCGTACTACTTCAACAATGTCGACAAGACATCGCGCTGGGAGCCGCCCA
ACCAGACCAACACGGAACAGCTCAAGCTGTACATGGCCAAGTACCACTCGGGACAGCGGCTGCAACAGCAGCAGGCGCAG
CAGCAGGCAGGAAAGATCCGCGCGGCACATCTGCTAGTGAAGCATCGCGACAGCCGGCGGCCGGCAAGCTGGCGGGAAGC
GGAGATCACACGCAGCAAGGAAGAGGCGCGCAGCATCATCTCGGGCTACGAGGATCGCATGCGGCGCGGCGAGATCTCGC
TGGGCGAGCTGGCACTGACAGAATCGGATTGCAGCAGTGCCCGCAAGTCAGGCGATCTGGGGTACTTCGGCCGGGGCGAC
ATGCAAAAAGAGTTTGAAGACGCGGCATTTGCGTTGAAGCCTGGCGAAGTCAGCGGCATCATTGAGACAGCCAGCGGGCT
TCATCTGATCGAGCGGTAAGAAAGGGGATGCCGCTCTTCTTGTCCTTATTTGTCACAGCACTAACGCACGGGCACGCAAA
CACAGCTTAGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62