GenePrediction:GLEAN_1340 Details

Name: GLEAN_1340
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2193613..2195193 (+ strand)
Length: 1581
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2193613..2194257 (+ strand)
Length: 645
Type: CDS
Source: GLEAN
Position: GCSC_173:2194480..2195193 (+ strand)
Length: 714
>GLEAN_1340 class=GenePrediction position=GCSC_173:2193613..2195193 (+ strand)
ATGGCAACTCAAGAGAGAAACAGTTATGACGCTCTGCAGGACAGCGGAGAGGCAGAGAACCTGGATGTGTCTGGTGACAA
TATTTCTGGCGTGCTGCCTGTGCACGAAACAGCGCTACGATCAGCCGTTGAGGCGTTGGAGAGCTCCACCGAAGCGATCT
CCAAGCAGACCGACATGATCCAACACCAGCTGGACGCGGTGGCCCGGCTCGTCAAGACTGTGGGGCAAGCCAACGAGTCT
CGCTCCAAGTTTGAGGCACGGCACATGCGGCAGTGGGAGTTTCGCCGAAACAACCTGCGTGTTGGTGTGGAGCAGCTGTC
CCGGAGGTTGAGCGACCACGTTCCCGAGGTAGAACAGCAGGCAAAGGGGACGCAGGGGTATGCTCAGCAGATGGTTGACG
GACTCTGCCGGCTGGACGACAAGCTGCTAGTCAGCCTGCAGAAGCTGGGCTGGGCACTGGCGGCTCCGGACGACGCAGAC
GAGCAGCAGACAATTAGTCAGCTGCGCGACATCTGCCTTCGGCTAATTAAAAACACAGTCGAGTCCATACGAACTAAGCT
CGACCGGATCTATCTGGAGGCCATTGAGGCGGCCTCGGAGGCTCGGTCTTCCTCCTGTGAAAACGGTGACGATGCAGGCG
CCGTGGTCGCGCTGCAGGACGAGCTAGAATCTCTGTACTCAGAAATTCTACCAGTTGCGCAAATGTCTGTTGACCAACAG
TACCTAGACCCTGCTCTCAAGTCCATTTCAAAGAGAAATGGGCGGAATACGGCGAGATCGCTGCTGGCATTAGACTATGT
GCGTTTAAAGGGAGCTTCGCAGGACCTCGTGGCAGTGCTGACGGTCGCTGTTTTCCTCCTCTTGCAGGTCAACGAGTGTC
TCGACTTTCTTCTCGAGCAGATTTACCTCCTCTCGGCACGCATACTGACGTCCAACTCGCATCAAGCTGCGACAAGCGCC
ATAGTCGCCACGGCGCGGTCCGAGGTTGTTGTGCAAACCTCGATAGCACGGAGACCGGACGAGCGACGATACAGCCTAGC
AAGCTCGCCCGCGCGCCACCCACGAGCCGGATACGGCCAGCAGCAGGCGTCTCCTGTGCGGCGACGCCGCTCCTCCGGCG
TAGGTCTGCTTGTCGACGTATCCCCTTTCGAGCAGCTGCTGCAGACGCTGTCTCTCCTGCTGCCAGAACCAGACGACGTT
GTCAGAAACGGCGGCGGGCAACACGCCGAGAGTGGCGACTACGGCAACATGGTTAATGCGCTGTCGTTGCATTCTACACT
AACCGACCGACGGTCCAAAGCCGACGGCGTAGCCACCAACGTGCAGGAGGCTTTTGAGGCAGACACTAATGCGCACCTGG
CCGACGGCCGTCGCGCACTGTGGATGACCCGCGAGTCGATTCTCGCAGAGAGCGGGTTTGGCGCAGTGCAGCTTCTGGAC
CCGGAGATTGACGGCTCCATCGCCGTGATGGCACAGGAGGTGGACAACATCCGCACGCGTCTCGGAGATGTCGCCGACAA
ATTGGCCGCTGCACGCAAGGGAAGCGAAAAGCGGGACAAAATGGTGGCCCGGTGGGGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62