GenePrediction:GLEAN_1343 Details

Name: GLEAN_1343
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2243730..2245772 (+ strand)
Length: 2043
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2243730..2244058 (+ strand)
Length: 329
Type: CDS
Source: GLEAN
Position: GCSC_173:2244131..2244339 (+ strand)
Length: 209
Type: CDS
Source: GLEAN
Position: GCSC_173:2244397..2245772 (+ strand)
Length: 1376
>GLEAN_1343 class=GenePrediction position=GCSC_173:2243730..2245772 (+ strand)
ATGAACATGCACATCGGCACGCCCACCCAGTCTTCCTCGGGCATGGGCACACCCACGCCGAGCATTCAGACAAAGAGTCT
CGCCCAAACCCCGTCACCGTCCACCCCGACTACAAGCACCCACTCGTCCGCATCGAAACGTCCTACGCGTAAGAGCACTT
TGACTCAGCAGCAGAAGAATCAGAAGCGGCAGAGGGCGACACAGGACCAGCTTACTACGCTCGAGATGGAGTTCAATAAG
AACCCAACGCCAAATGCCGAGACACGGCTCTTGATAGCCGACCAGATCAACATGACCGAAAGGTCTGTTCAGATCTGGTT
CCAAAATCGGTATGTCTATCCCCTTGATAGCCGCAGTCTGGTAAACATTGGCTAAAATTGAACTAACCGCTCATGTTATA
GACGTGCAAAGATCAAGCTTCTGGCGAAGAAGAGCCTCGAAACCGGCGAGGACATCGATATGATACCCGAGTCAATGAGG
GCTTATCTCGCTATGCAGGCGGCTGAGACTGGAAAGGGCCTCGGCGGTGCTTTCTACGGGCGCACCGGCTTGTTGGGCTA
TGGTCCTGGCATGCTTCTTGGCGGTGAACAGACAAACCAGGGCAAAGTTTGTGAGTATCAATTTGTTGTCGGCTTTCGAC
TTACGATCCTCTTGACTAACTTTTCAGTGATACATCATCTTACGTGCCGGTCCCTGAGTATTGGAAAGTGGATGCGTGTC
GGCCAAAACACGATGGACCTCATCGTGTTTTACTCTCCGGATAAGTGCACAATGACGTACTACATCAACAATGAGAACGC
AGGATACAAGATCGAATATCCATTCTCCTACATCAAAAATATTTTCCTCGACAACAACGAAGACGATTTGAACAAGGCCG
GTGGCATTGTTATTGAGCTCAACCAGCCACCCAACTTCTTCATGGACTCCTCTCCTAGCACGAATGGATTCTTCATGGTT
GGTGACTTCACCGAGAACCAGCAGGCCTCGCAGTGTCTTGTTCATCATCTTGGCGGCAACCCGAAAGTTCTGAGTGGCCA
ACTGGCGAAGCTCATATCTCTGGAGTCGTTCATGACCCGCCATAGCCCTCACAACCCACACAATATGGCCGTGGCTGCCG
CAGCTGCTGTGGCAGCAGCAACGGGCTCAAATGGTCATATGGCGGCGCCCATCCACATGGACTCCATCCACAATTTGTCC
GTGTCGGCCCCGGTCTCACCCACCGGGCGTCCGTCGTCGCAACCAAACTTTCTCCAACCGCACGTTGGGCTGTTCCAAGA
GACGCAATGGGGCGTGGCCGGTGTAAACCAAAGCATGCACTCTGGCCCAGGGCACAAGCGGCAGCGCAGTCGGTCTGTGC
CCATGGCGGTGGATTTCTCGATGTTGCAGACACCGATGCCGTCTTTTTACATTCAGCACCCCGGCGAGACGCAGCCACAC
CCGCACAACCCGAACATCTACGCACCGATCCCCCAGCAGCCCAATGCGCTCAGTCCCGTTGGCCCGAATCTACGGATCGA
CACACAGGCTGGCTTTGGTCTGGACATGCGGCAATACCCAATGTCGGCAACTACAGCGCCATCTCCGTCTGACTACTCAA
GCCCCAACTATTTTGCTTCTCAGGTGCCGGAGTCTGCGACCATGTCGGCATCAAGCTACAACAATCCTTATGGCACGGCT
TTTCTGTCGCCTATGGTGGATCCGCAAAACATGGTGCCGCCGCAGTCTGTCTCTCCTTTGTCGTTTGACGGCCGTTCTGG
TCCGTCAATCGTGGACCAGTCGCCACCAATGTCTATGATGGAGCGCAGCGCATCTGCTGACATATACCCGATGCATGGCG
GCTCCTCGGCCATATCCGACGACGGGACCAGCCTGAACGAGATGTACTCGAAGCACACCATAAATCTGCCTCTGCACCAA
CAGTCGCCATCATCCTACACGGAGCAAAGTCAGGCCGAGCTTGCCATGCACCAGCTGGTTCAGTTTGACGGTGTCGATGC
AGCCAGCCTGTCTCCTGACAGCATGTCGCATTCTGTGGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62