GenePrediction:GLEAN_1345 Details

Name: GLEAN_1345
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2266573..2268463 (+ strand)
Length: 1891
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2266573..2266668 (+ strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_173:2266737..2266771 (+ strand)
Length: 35
Type: CDS
Source: GLEAN
Position: GCSC_173:2266834..2268463 (+ strand)
Length: 1630
>GLEAN_1345 class=GenePrediction position=GCSC_173:2266573..2268463 (+ strand)
ATGCAACAGTGTTCCAGGTTTTTAAAAACTGTCGACAACAAAGCACAATACGCTGAGCTCCGAATCCTGCAGAAGGCTCT
TGACAACAAGATCAAGGTACGTTCAGTTAACCTCAGTATGCTGAAAGCGTTCTTGCAGGTCTTCGTGAGTATTGACACTT
GCAGATTGTATCACCAGCTTTGGATCTAATCGAATTTAGGTATTTATATATATCGTCAGTACCCATGCTTTAGCTCACTT
CTACTGACCCACCCTGCAAAGATCTGGTCGCGGCAACGTTCTTCTAGGAAACGCTGCGAGCCTCACGAAGGGTTTGCACC
GAGACATTGTGAGCTTGGGAAAGCGTCTGGAGAGAGCCGCCGCTACCGAGGAGCTGTACCTTGCAACTGGCAGCCGAGAA
GTGTCTGCGGAATGCCATCGTGTTGAACTCCTGGGTATCATCAACGATATCAAGTTGCTGCTAGCGCGCATTGACGGCGA
CATTCCATTTATCCAGCTTGCCATCACAGCGTCTGGCGAAAGCCTTTCGACATCCCTTCCAGCAACCATCTCACCGTCCA
GATTGCTCCAGGCAAGCATGTTTCTCACAGTTGGTGATACGCAGTTTAACAGCACTTCCCGAAATCCCACGCAAATTGGA
CCATCCTTCACCTTGTCCTTGTACATGTTGTTCATCAGCCATTGTCCATCTATACAGGACTCAGGCAAGCAAGTGAACAG
CCTGTCAGATAAGAGCCAATACGGGGGAGGTGTGGAGGACGTGAAAAAGGCAATATGGCAAGAGGTGGTGCACAAGGCTC
GTGTCCGGCTTATTTGGATGAGCCCTGACTGGGTGTTCGATCAGAAGGTAGGAGATCTTCCCAAAACTCCGTCTATGACC
GGATCGGGCACGGATTTCTGTTCCAATACCAAGGTTGGTCCATTTTCTGGGATGGATGGATATTCCTACCACCTGGAAAT
TACCGAAGACCTAGACGATGGGCGAGTCCATGAAGCGGAGGACCAAGAAATGCGTCGAGCAGGAATCCGCGAATCGATAC
CAATCCATCAAATATCGAAAATATTTTATACCGACACTGGACGGATATTGAATATTGGGGAGACGACCTCCTTCGAGAGC
AATGCTGTTCTGCTACTGAAGCGGGATTCTTGTGCCACGGTGCCGACTTCAGCGTTGGATCATATAAAACCACAGCAAGA
TGTGGACACGGAAACAGGACCGTGCCGCTATGAAGTTGTAGAAAGGCATCCGCTACTAACTAGCCAAGGAGACATCGATC
GGCAACTCAGAAGAGAAGCAGGATATTTCCCCGCTGTAGTCGAGCCTGCTACCACTGACAAGCATGGAGAAAGGCACTTC
CCCCGCCATTTAGACCCCGAATGGCTAGCATTGGAAGTCTTTATCGAGGATGACGATGTGGGAAGCGACGAAGACGCAGA
GAATGGGGTTGGGGACGAGGACGAGGATCATAACGAAGAGAACGATTTGACTTCCGATACTTTAGAGCAGATCCGGCACC
TGTCCATGTCTGGAACGGAACCGGCAAAATCACAAGACCAGTATGAAGAGGGCCATGCAGACTTGAAAAATGTAAACATA
AACATGCAGGACACTTGTTATGCTGGAAATCCTGGAGAGGGGCCACCTGCGTCTTGCTCGCTCCTTGGAACGGCCGCATC
CTCTCTTTCGTTGCTTGAAATGCTGATACGGCTCACCAGTCTTCAAGAGTTTCAACAAGTGTCCCATCTCTCTCTTCCGG
ACCACATCCTGACATTTTTCCTCGAAGAATCCTCAACGACAGGACTGTGTGGAGAGGAGCAGTGGAAGGCCAAGAAAGAA
GCAAAGCAGAGGATGGGTTTTGATCCATATATTGATACCCCGAAGTCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62