GenePrediction:GLEAN_1346 Details

Name: GLEAN_1346
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2268907..2269518 (+ strand)
Length: 612
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2268907..2269039 (+ strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_173:2269112..2269518 (+ strand)
Length: 407
>GLEAN_1346 class=GenePrediction position=GCSC_173:2268907..2269518 (+ strand)
ATGGCTTCGATTGCTCGCTGCTGGAGGCTCGCCGCCCGGTCTCCGATTCTGGCGGCCCGTGTAGCACGGCCGATGACAGC
TTTCCGGCCTGCTGGCCAGGTGACCGGTCGGAGCTTCTCTGTCACGGCACAAGGTGGGAAAGGAATTTCAGAGAGGATGG
TGTATTTGGGGACCGGTACTGACTGTCTTGCTCTTGCGCGTGCAGTGGCCCTGCGGAAGTACACCAAAGACCACGAGTGG
ATCGACCTGAACGCTGACCAAAGCTCTGGCGTGATCGGCATCTCCGAGTACGCGGCCGAGGCGTTGGGCGACGTCGTCTA
CGTTGAGCTACCAGAAGAGGGCAAGGAGGTCGGTCAGGGCGATGCTATCGGTGCGGTCGAGTCGGTCAAGTCGGCTGCCG
ACATAAACGCGCCGATCTCTTGCAAGATCACGCACATCAACCACAGCCTCGAGGAGAAGCCGGGCACTATCAACCAGGTC
CCCGAGGACGATTCGGCCGGTGGCGGCTGGATTGCCCGCGTGCAGGTTGACGCCCAGGGCGTTAAGGACTTGGAGACGCT
GATGGGCGCCGAGGAGTACAAACTGTACACCGCGACGGTTGAGGATCACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62