GenePrediction:GLEAN_1348 Details

Name: GLEAN_1348
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2274875..2275344 (+ strand)
Length: 470
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2274875..2274893 (+ strand)
Length: 19
Type: CDS
Source: GLEAN
Position: GCSC_173:2274946..2275261 (+ strand)
Length: 316
Type: CDS
Source: GLEAN
Position: GCSC_173:2275317..2275344 (+ strand)
Length: 28
>GLEAN_1348 class=GenePrediction position=GCSC_173:2274875..2275344 (+ strand)
ATGGGTTTATTCGGATTTGGTAAGCTTCTCACACACACTCCCACCTTCTACTCCTGCTGATACCTTCTCAGACGACGCTC
GCGAGGCCCGCAACGAGGTTTACAACGGCCAGCCGCACGAGAGCAAGGTGTCCCACGAGCTGCTCGGCGCTGGTGCCGCC
TTCGCGGCCGTGCACGAGTTCGAGAAGAAGCAGCGCGCCGAGGGCAAGACTGTCAACCACGCCTTCGCCAAGGAGGCCCT
GGCTGCCCTTGCCGGTGCTGAGGTCGACAAGCTGATCGAGACCAAGGGTCTGGACTTTGTCGACCGCGAGAAGGCCAAGC
ACCACGCTCGCGAGAACGCCAACCACCTGTACGACCAGCAGTACAGCGGCCGCGACAACTTCAACCCGTGAGTACAGATC
AACGCGCGAGGCTGCGTGAGCACTGGCTAACGGCGTCTACAGCAACGAACACGAGCAGCCGAACTACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62