GenePrediction:GLEAN_134 Details

Name: GLEAN_134
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:901795..903110 (+ strand)
Length: 1316
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:901795..901827 (+ strand)
Length: 33
Type: CDS
Source: GLEAN
Position: GCSC_179:901914..902959 (+ strand)
Length: 1046
Type: CDS
Source: GLEAN
Position: GCSC_179:903026..903110 (+ strand)
Length: 85
>GLEAN_134 class=GenePrediction position=GCSC_179:901795..903110 (+ strand)
ATGATGTCCCGGAGCTCCTCCCGAACGGCCCAGGTGCGTTTTCACATGTGAAGAGAGGATCCCGTCGATCCGAAGGGGAT
GTGTTGGAGGTATGAAGTAGCTAGCTGACACGCGGACAGGGCCTGATGCGGACGGCGACGGTAGCGTCGCGCACGCAGAC
GGTGTCCATGGCAGCCCGCAGCTTCGCGACGGTGCAGTCGGACATCTTCAAGCCGACAAAGTACGGGGGCAAGTACACGG
TGACGCTGATTCCGGGCGACGGCATCGGCGCGGAGGTGGCGGAGAGCGTGAAGACGATCTTCAAGGCGGACAACGTGCCG
ATCGAATGGGAGCAGATCGACGCGTCGGGCGTGGACGACTCGGCGCCGGCTGGCCGGACCGAGGAGCTGTTCAAGGAGTC
GGTCACGTCGCTGCGGCGGAACAAGCTCGGCCTCAAGGGCATCCTGCACACGCCCATCTCGCGGTCAGGCCACCAGAGCT
TCAACGTGGCCATGCGCCAGGAGCTGGACATTTACGCGTCCATCTCGCTGATCAAGAACATCCCCGGCTACGCGACCCGG
CACGAGAACGTGGACCTCTGCATCATCCGCGAGAACACGGAGGGCGAGTACTCGGGCCTCGAGCACCAGAGCGTCCCCGG
TGTCGTCGAGTCGCTCAAGATCATCACGCGCGCCAAGTCGGAGCGCATCGCCAAGTTTGCCTTTAGCTTCGCGCTGGCCA
ACAACCGCAAAAAGGTGACGTGCATCCACAAGGCCAACATCATGAAGCTCGCCGACGGCCTCTTCCGCAGCACCTTCCAC
GCGACCGCCAAGGAGTTTCCCACGCTCGAGGCCAACGACATGATCGTCGACAACGCCAGCATGCAGTGCGTCAGCCGCCC
GCAGCAGTTCGACGTCCTCGTCATGCCCAACCTGTACGGCGGCATCCTGTCCAACATTGGCGCCGCCCTCGTCGGTGGCC
CCGGCATCGTGCCTGGCTGCAACATGGGCCGCGACGTCGCCGTCTTCGAGCCCGGCTGCCGCCACGTCGGCCTCGACATC
AAGGGCAAGGACCAGGCCAATCCCACGGCCCTGATCCTGTCCGGCGCCATGCTGCTGCGCCACCTCGGCCTCGACGACCA
CGCCGACCGCATCTCCAAGGGCATCTACGCCGTCATTGCTGAGGGGTACGTTTCTTTTCCTGCTGCTCTCTCTGTCTCTT
GCTGTCTTTCCATCCTGCTAACCCCCAACAGCAAGGTCCGCACCCGCGATATGGGCGGCATCAACACCACCCACGAGTTC
ACAAAGGCCATCCTTAACAAGATGGAGGCCCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62