GenePrediction:GLEAN_1350 Details

Name: GLEAN_1350
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2278271..2281620 (+ strand)
Length: 3350
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2278271..2278330 (+ strand)
Length: 60
Type: CDS
Source: GLEAN
Position: GCSC_173:2278410..2278597 (+ strand)
Length: 188
Type: CDS
Source: GLEAN
Position: GCSC_173:2278658..2278758 (+ strand)
Length: 101
Type: CDS
Source: GLEAN
Position: GCSC_173:2279740..2279818 (+ strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_173:2279889..2280713 (+ strand)
Length: 825
Type: CDS
Source: GLEAN
Position: GCSC_173:2280774..2281620 (+ strand)
Length: 847
>GLEAN_1350 class=GenePrediction position=GCSC_173:2278271..2281620 (+ strand)
ATGTCGGCACAGAACTACTACCAAGGCCAGGGCCAGGGCCAGGGCCAGCAGGGCCAGAACGTACGTTACCGTGTGTTGTT
GTTGTTGTTGTTGTTGTTGCTGCTATCACGCTGCCTACAAATCCACTGACCAGTCATAGTACAATCAGGACCAACAGTAC
GGCGGCGAGAACCAGGGCTCGGGCGAGCGTGGCATTGGAGCCACGCTCGTGGGCGGTGTTGCCGGTGGCTGGGCGGCCAA
CCACGCGGGTGCCGGCAAGATGGGCACTGCGGCCAGCGCGGTCGCCGCCGCCGGTGTGGCCAACGTGGTCGAGCACTTTT
TTGAAAAGTAGGAGCTGCCAGCTACAACTCCAATCAATGACTGCCACATCATGCTGACCCCCCATAGGAAGCACTCAGAG
CACAAGCAGCACGAGCAGCAGATGCAGGGCGGCTACGGCGGCCAGCAGGGCGGATACCAAGGCAGTCACCAGGGCGGTCC
CCAGGGCGGTCCTCCGGGCGGATATGGCGGCCCTGGTGGTGGTGGCGGTGGTGGCTCCCGCGGCTTTGAGGGTGGCGGCC
CTGGCGGCAGTTTTGGGGGCCCTGGCGGCGGCTTTGGCGGTCCTGGCGGCGGTCCTGGCGGCTTTGGTGGTGGCCCCGGT
GGCCCCGGTGGCTACGGCGGCCCCGGCGGCGGCCCCGGCGGTCCGGGTGGCTTTGGCGGCGGTCCTGGCGGCCCGGGAGG
CTATGGCAGTGGCCCTGGTGGCGGCGGTGGCGGTGGCCGTTGGTAGACGGCACAAATCACGCTGTTTGCAGTCCAAGTCA
CGTTGTATGAAAGCCGTCTTTTTTTTCTACTGGAAGAGACATAGCATAGCATGGCCAAATGTTTTCTTCTATCACGAGTG
TCCGTGTATGTGACAGGCATGTTGGATGGTGGTCTAAGCGTTGGGGTCGAGATGGAAATTGGAGTGCGAACTGCAAGCTG
CAATCTGCAAGCTGTCATCTCTCGTGTTTTCGTGCTTTGCTCATGCTTCGGGCCCGGAATCGGCTCCTATTGGTCCATTG
GGGCGAGGTTGGCGCTCCGAGACGGCAGCCTCTCGACAGGCTCTCGAGAGCTCTTCAGCCCGGACACTATTTTGCTTTGG
CTGCTTGTCTGGCGATGGCCACGTGAGGTCCGAATTAGAATGACAGAGCAGCGATCCTTTTGGTAGGAACTCGAGCTGTT
ACCAATTACAGAGTATGGGCCTGGAAGGAGCCGTCGATCAGCACCTTCCTCAGGTCTCTACGTCGTAGGGAACATGGGCA
GCCAGCTTCCCCTTTCGGCCAAAGGCAGCGTTCTCGCACGAGTGATCGCCAGAGGACAGTACATTTGTAGCCTGCCATTG
TAAATCCCACAATGTCTGTCTCCTCCACACCGCAACTCCGTGTCGTGAACATTGTCTGCCATCATGGCTGTGTTTGCACG
CTCGCTTCTTGTTGGCCTACTTCTGCAAGTGCCCTACGCCCTGTGTCAAAACGAGACGGGCGTCCATACCGACTGGCCAC
GCTGGTGCGGCAAGGTCTACGAGCCAGGGTGAGCAGCTGAGTCCGCCTTTGGATCTTGCATGTGTGCTTCTCTGCTGACG
ACCTTCTTCCCTCTGCAGCTACCCCAGCTTCGATCCAGGCGGTCAGACGGTTGAGCCAGAAGCCTCCCCAGATGCGCCAC
TGCTCTACGTCCAGCTGGCTCCGCGCTACAGCCTCTACCTAGACAGCGAGCCCGAGGCTGAGCTGATCGTACGCACAACC
GTGTCGGACTACCACGGGAGTCCCCTGCCGGCCAACGTTGACGGCTCACGGCCGACACCCGGCCTCTACAAATTGCCGCA
TGTGCTGCACTTCCACATCACCGCTGATGCCTCTGGCCTGGAGCTGACCGCCGGCGTGGCTCTTCTTGCGTCGACCAGTG
CCGACACGATCGTGTCGTTTCGCCTCGCCGAACTCGCCGGCCTCACGGACCGAGACGTCAACATAACCCTCACCGGCTGG
CTGACTAGTCTTGATGGCACTACAAATGCCACCTACACTGCTGCAACCGCCCTCTCGTGCCTGCCGGAGAAGACTAACGG
TAGTGTTACCCGAATCGATAACCTCTACGGCGGTTTCCTCTTCCGCAGCGCCGCCACGCACGGCCGCTTTCAGCCCTTCT
TCCCCTACGGCTATTATGCCTCCAACGACGGCTTTCTTGCCAACGCCACTGATGCCGCCTCGGCTGCTTCCGTCATCGGT
CACTATTCCGCCTACGGCCTCAGCGGTATCACTCCGCTCGCCCACTATCCCGAGTCCACCGTCGCCTTCGAGTACATGGA
GACTGCCGATCTGCGCTTCCAATTTGACCTGCGTGAGGGCTACACTAACCTGACCTGGGTTGCCGGCCAGGTCGCTGCTG
TCCGCGACAACGCCGCCCTCTTTTCGTACTGGAGTGCGGATGAGTGCGTTACCTCCACAGTCCCTTAAACAAAGCGTGTT
CGCACTCACAACCCCCTTCACAGACCCGATGGCCATCAGGACCCCTTCGAGGCCGCCGTCAACGCGCGCAATGCTGTCCG
CAGCATCGACCCATATCATCCCGTTGCTGTCGTACTCAACTGCCAGAACTACTACTATGGGCCCTACACAGCCGGCTCCG
ACTTTGTCATGGAGGACGTCTATCCAATCGGCATCAACGCAACCTACTCCAAGTGGGATACTGCCGTCAATTCCACCTTG
GGCGACTGCGGCTGCGACAACTGCGTCGGTGGCGGCCATGCCGTCCAGGACGTGCGCAACCGCCTCGATGACATGGCTCG
CTACGAGGCCTGGCTCGGCCTCTGGCCCAAGACAAAGGTCCACAACCCCCAGAGCTTCAGTGGTGAGGGCTACTGGTCGC
GCAACCCCACCCCGGCCGAGGAGTGGGCCACCGCCCTTCTGTCCGTCAACCACGGTGCCCAAGCCCTTATCTCGTGGGTC
TACCCGGCCCCTGAGGTCCTCTCCGTCGCCCACGGCCAGATCGCTAGCGTTCTCTCGCACAGCCCCGTGCTCGACTACAT
TGTCGGCAACAGTTCTCCAGTTGCCCTGCTTGTCAGTAGCAGCAACAGCAATGCTGTAGATGTGGCCTGCTGGCAGCGCA
ACAGCACGCTGCTGGTATCCGTCGTTAACAGCGGCTACGATGACGTTGCCGGTCCTATCAAGATCGCCCTACCCTCGTCC
GCTTCCGGTGCCGCCCTACACTCAATCGAGAGAGTGCCGTGGGGCAACCTGACCTGGTCGTGGACCGGTGGCGAGCTCGT
GTCGGCCGCCGGTGTCCCGGCCCTGGCCAGCAGCCTGGTCATTCTGTCTTGGGGAGACATACCCACCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62