GenePrediction:GLEAN_135 Details

Name: GLEAN_135
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:905656..912474 (+ strand)
Length: 6819
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:905656..906149 (+ strand)
Length: 494
Type: CDS
Source: GLEAN
Position: GCSC_179:906217..906552 (+ strand)
Length: 336
Type: CDS
Source: GLEAN
Position: GCSC_179:906606..906835 (+ strand)
Length: 230
Type: CDS
Source: GLEAN
Position: GCSC_179:906894..906949 (+ strand)
Length: 56
Type: CDS
Source: GLEAN
Position: GCSC_179:907009..907130 (+ strand)
Length: 122
Type: CDS
Source: GLEAN
Position: GCSC_179:907193..908266 (+ strand)
Length: 1074
Type: CDS
Source: GLEAN
Position: GCSC_179:909124..909240 (+ strand)
Length: 117
Type: CDS
Source: GLEAN
Position: GCSC_179:909308..909425 (+ strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_179:909484..912474 (+ strand)
Length: 2991
>GLEAN_135 class=GenePrediction position=GCSC_179:905656..912474 (+ strand)
ATGTTTGTCCATCAGTCTTCTGTGGCCATGCTGCTCTGGCTGGCCGGCCTCCTCATCGTCCGGGTCGGGGCCATCGATCT
CTACGACTTGCAAGGCGAGTGTGCGCTCGGACTGGTGATTGTCTACGGGGCCTTCACTTATCCCGGCATTGGTTACCCGT
CCACCTACCCGATGCTCTGCCAGAACCCGGTTGCGGTCGTGTCGCTGTACGCGGCCATGGCCGTCTACTGCGACGATGCG
CAGACAGCCGCGGGCCTGCCGAAGCTGGAATTGCAATGCACCGAGTATGCCGAGGTCGGGATGCTGTCGGCCGAGGCTGT
GGCCGCAAACCTGACGCCCGAGGCCATCGCCACGCTGCCGGTCTACGGCCAGGCCGACCTGGAGCCCGGATCGAACGTGA
CCGAGGCCTTTCTGCCAGACCAGGCCTGGTACGAGATCTCGTACAAGTCCAGCTACAACTTTGACTACGAGGAGAACCAC
CATGCCTATTACACGTGAGTTGGGTTGGTGTCGCTGGCTGGCGATCTCTCCCACCTGCTTACGTAATCTCACGACAATCA
GGTACGCCCTTTATGGCTTCTGGGGTGCCATCCTCCTCTTTGGCATGGCACAGAATGCCGTCCGCCAGATGGCCGAGAGA
CGACGAGGCCACGGCCGTGCCGACCTGGGGGGCTCTCAAGGCCGGCCGGCGACAGCAAGACCTGGCCTCGTCGGTCGTGT
GGCTGCCCTGGCAGACAAGCACTTTGTGACGCCCAGTCTGCTGCCACCCTTCCACCAGAGACGTCTCCTGGGCTGCACGA
TTCCCACGCGGGCTGTCGGCTTTGTGATCGCGGCGTATTGGATCGTCAACTTTATCCTGTCGTGCCTCCACTACCGCGTC
TTTGCCGGAGACTATTAGTAGGACCAGCCTCTTTCTGCTTCTGGCCACTTGCAACTACTGACAGCATCAGCTTCGCCACT
GTGGCCTTACAGATGTGGCGGTATATTGGCGACCGGACGGGCTACATGTCTTACGGCAACCTACCGCTGCTCTGGATGTT
CTCCGGTCGCAACAACGTCTTCCTCTGGCTCACGGGCTGGAGCTTTACCACGTTCAATCTCTTCCACCGCCATATTGCTC
GCATCGCCACCGTCCAGGCTATCATCCACTCCATCGCCTATACGGTCATTTACTGCGCTCGTGAGTCTTTGTATTGCCCA
GCTCTTGCGATGCGATGCTGATAGGATACAAACCATAGCCGATGGAGGCTACCGAGAAGCATACGACGAGTTCTGGTTTA
CGGCCGGTGTAATCGTGAGTACTTTGTGCCAGAAGTAGGCGTGTAAAATACGAGATCCTCACAGTCCCCCTAGGCCACCG
TGGTGATGAGCTTTGCCGTCCTCTTCTCTTTCAGCGTCTTCCGGGCCAAGCTCTACGAGTCCTTTCTGCTGGTTCACATC
GTCCTGTCCGCCCTCCTGCTGGTCTTCCTGTGGTAGTATGTCTTGTTCCTATGTTCCCGCTGCGTCTGTGACTCAGCCTT
TTGCTGACAAATCGCAGCCACACCAACATCTTTGCCCTCAACAACTTCAACTACCCGCTGCTGCTACCGCCCGTCGTCAT
CTGGGCCTTTGACCGCTTCCTGCGTCTCATGCGCCAGCTGTACTGCAACGTCCACGTCCGCCGCGTCCGTGGTTCCGGCC
GTCTGCAGCACACCCGCACCACCGTCTCGTTCAGCGCGGCCGCCAACATCCTCACTGTCGATGTGGTGCCCGGCAACGCT
GGCCTGTCTGCTGGCCCCGGCCAGCACTACTACCTCTACCAGCCGCTGCGCCTTCTCGGCTGGGAGAACCACCCGTTCAC
CCTCAGCTACTGGAGCCCACCGGACGGCTCCTCCGCCGACAGCGATGCCCACCTCTGCTTCTACATTCGGCCCTACGACG
GCTGGACGAAGACGCTGCGGCAGGCGTGCGTCGCTGCCGACGGGACCATCCCGACCTCTGCCTCTGGCCCGGCCATGTTC
ATCGAGGGCCCCTACGGCCTCGCCGAGCCGCTGCACACGTTTGAGCACGTCCTCTTGGTGGCCGGCGGCTCTGGCATCGC
TTGCATGCTGCCGTACCTACAGGATCACGTGACGCGAGTCGCCTCCAGAAAGACGGTCACCCAACACATCACACTCGTCT
GGGCCGACCGCACCGAAGCCTTTATCCGGCTCGTCGCTGACGGCCCGCTCGCTCGAATCCTCGGCCGTGACGATGTCGAC
TTTGACGTTTACCAGACTGGTGCTGCTGCCGTCTCCTCTACCTCTACGCACAGCAGTCGCGGCACCTCGACCGAGGCCGT
CGATCCCGAGAAGAGCGGCGCAGGCGGCGGCGTGCTCTCCCGCGACGAGAGCCTTCCGTCTCCCGGCGCCAGCACCCCGA
CCAAGCGGACCGCCATCAGCATCCATGCTGGCCGCCCGGACGTGGAGTCGTACGTCTGCAGGACGAGCGCTGCCCTCCAG
GACACAGACGCGCGCCTGGCTGTCATGGTGTGCGGCCCGGCACAGCTCTCCGACAGCGTGCGCGCGGTGGTGGCGCAGTG
CATGGACAAAAGGCGCCGGTCGATCGAGTATTTTGAGGAGACGTTTGGCTGGTAGTCTCGTATTATTCCTTGTCGTCAGA
TATCTTAGTTCGTGGTTGCGAACCATAGTTTTCCTGTTCTTACGCGACATCACGTGACCACGCCACTCTCCAGTCGACCC
TTAATTACCTAACCGAGGCGCTGGACAGGCCGCTCTAGGAAGCTGTGACAGCACCTGCAGACGCTGTGCAGAGTTTGCTG
CCGATCTTGCGACGCTGCGTTCGCGTTCCGTTATGTCAGCAGGTCGACATCCCCTGTAATCGTAGGCTAACCTGCTGATG
CGGTTTAGTGGACCCCCCCACCTCGTCTCTCTTTCCCCCCCCCCAAGCCAGCGGGCCTAGCGCCCCTTTTACCGCGAGCT
GGCGCGTTAGGTTGTCTCTCCGCCCATTTCGTCGACAAAACGTCGACCCCATCCCCATCGAGCCACGACGGCAGGCTCAG
ACGAAACGAAACGAAACGACCAGATTCGGCAAACTGTCTGGACGACCATCGGATCGACAGGATATTGCGTATCTGCCACC
GAGTACTGGCGCATAGTCTACGGCTGCTTGCTCTTCTGTTGCGACAGGCCCATTCAGGGGCTCATTTCTGCAGTGAAATC
CCGGCAGCGTTCTTGGAACTCGCTTCTTCTATCTGCTTTCCCCGACAGCCTCTTACCTCTTACGGCCGCACGCTTCCGAG
CCACTAGGACACCTGCCCCAACTAGCCGGTGCCACGAATCGCGTATGGTACGAGCGTGTCTGCTCCCGCTTTCAGGCCTG
AGAAAGGCGACGCCTCCGAGACCGGATCCATCGAGTGTCCTTAATCTGACACGACTGCTCCCCGACCCCAATCCACACAC
GTGGCAACCCTTTTGCAGTTCGGCCCAGCCCGGACGGAGGAGGCGGCGGTGCCGCCGGCGGCGGAGGGATGCAGGTGGCA
AGAGCAAAGGCCGAGGCGCAGGGCCGCAAGGCCAAGCTGACCAGCTCATACCAGGAGCTCCTCGAGTAAGCCAGGTGCTG
GGCGGGAGGACTCGCCGGACAAGAATGGACTGTGTATGCTGACGGTAGCTAGCGAGTTCGCCAACAAGGACCTCAAGTCG
GTCGGCAACTACACTCTCGGCCGGCTGATAGGAAAGGGGTCCTTTGGCAAGGTGTATCTAGCCTCCCACAAGCTCACAAA
TGGGTCCAAGGTAAGTGGAATCGAGCTCGTTCTGGGTGGGTGTGTCTCCCTGTGCTGACCGGCTGCAGGTCGTTCTCAAG
TCAGCCAAGAAGGAGGACTCGAATCTCGCGCGCGAGATCCACCATCACCGACAGTTTGTCCATCCACACATTGCGCGGCT
GTACGAGGTGATCGTGACGGAGTCGATGGTGTGGATGGTGCTGGAGTATTGCCAGGGCGACGAGCTGTACAACCACCTGC
TCAAGCACGGGCGGCTGCCGGTCGAGAAGGTGCAGAAGATCTTCACGCAGCTGGTGGGAGCGGTCTCGTACGTGCACCAG
CGGTCATGCGTGCACCGTGACCTGAAGCTGGAGAACATTCTGCTGGACAAGCACGAGAACGTGAAGCTGGTGGACTTTGG
CTTTACGCGCGAGTACGAGGGCAAGGCCAATTACCTGCAGACGTTCTGCGGCACGATCTGCTACTCGGCACCGGAGATGC
TCAAGGGCGAAAAGTACGCGGGCGAGAAGGTGGACGTTTGGAGTCTGGGCATCATCCTGTACGCGCTGCTCTGCGGCGAG
CTGCCGTTTGACGACGACGACGACGACGTGACGCGGCGGCGGATTCTGACGGAGGAGCCGGTGTACCAGGAGCAGCTGAT
CCCACCAGACGCGCTGGCTCTGATCCGTTTGATGCTGTCGAAGCGCCCGCTGATCCGACCGTCGCTGCCGGACATTCTGA
GCCACGCCTTCCTGGCCGAGCACGCGCCGCAGCAGCAGGCGATGTTGAAGCTGCAGCGGCCGGCGCCCTTCTCGACCGGG
CTGGAGAAGGAGACTTTGGGACGGATGCGCAGCGCTGGCGTGGACATTGACTCGGTGATCGAGTCGGTGCTGGCGCAGCG
CTGTGATGCCCTGGCCGGCTGGTGGGCGCTGCTGATCGAAAAGGAGCAGCGCAAGGAGGCACGGCGCGAGCGGAAGCGCA
AAGAGAAAGAGCAGGAGCGGCGGAGCTCGCGCCGGTTGTCGGGGGCGTCGAGCCGGTTAGAGCGGCTGGCAACGGTGGGC
GAAGAGGGTGGTGGCGGTGGACTGGGACTGGGACCGGGAATTGTTTTTCTGGGTGATCCACCAACGCCCAAGTCAGCACG
AGGTCGATCGCAGAGACGGAGCGGCGCATACGAGCTGCGGATCGAAGACTTTCCCGGACTCAAGGAGCTCGGGCAGCTGA
ACGACGTCTCTCTGGAGCATCAGCCGCAACAGCGACCGTCACAGCCACCACAGACACCACAGCCACAACCACCACCGACG
CCGGTGGACAAGGACTCAGTCAGGTCGGCGAGCTCGTCGCGGCATCGACGGCCGATTCCGCCGCCAAAAGAGGGCATCCT
GCGCAGCGCACGGTCGCGGGGCTCGACGCTGCACCTGGTGACGACGACAGACGCGCTGGAGGCCGTGAAGGCGGCACAGG
GTGGTGGAGGTGGAGGTGGAGGTGGTGGTAGCGGTGGTGGTGCCGGCAGCAGCAGACATGGTCACGACGGAGACGACGAC
GAGCTGGACGAGGACGGCCAGCCACGGGATCGCAAGGTGCGCAAGAAGACGTCGCAGGTGATCATCACACACTGGAAAAA
CATGACGCACTGGATCGTGGAGAGTGCACGACGAAACAAGGGACCGGGACGACGGGGTGGCGGCCACTCGATGCCGAACC
TGGTGTCGAAGCCGGGAAGCGTTGGTAAGGATGGCAAGGAGAGCAAAGACGGGCGTGGCGACAGCAGCCCGCGACCGCAG
ACGAGCAAGTATCCGCACTCGTCGTCGGCCGGGATGACGGCATCAAACACGGCCAGCCTGCCACGAAGCATGATTGCGAA
CGGGTTTGGCGGCAGAGGAGGAAGTCGAGGGGGAAGCAGTGGAGGAGGGCCTGGAGGGGGAAGTGGAGGAGGAGGAGGTG
GTGGTGGTGGTAGTAGTGGAGGAATTGGATGTGGTGGATGTGGTGTTGGTGGTGGAAATGATGGATCAGCAGCGACAGGA
AGTGGTGGTGCAAGCCTCTCGACGATGCTGGACGCCAGTGGAAGTGCCAATGGAAACACCAACAACGCAAGCGGCAACGC
AAATGCTCGAAACAGCAGCAGCCAGAGGTACAACAACATTGGCGGACAGACAGGCGCCATTTACAACAGCAACGGCCAGC
CGCCACGGCTGCAGACGACGACAACGATGACGACAAGCGGCAGCAGCGGGTCGTACAACCGGCAGTCGTTGTCGCCGTCA
CCGCTGACGCCACGATCGACGGTGCGACGGCCGTCAGCAGCGAATCATGGGCTGCGAGGCCGCAAGTCGACGTCGTCGTC
GGTGTCGTCGATCCGGTCGATCCACCATCACCACCAACACTCGCACTCCAAGGCGTCGTCGACGAGCTCCAACGGGTCCG
TGTCGACGGTGATGTCCAAGACCCCGTTGCCGGCCGGCCGCTCGCCCCATCACTCGGTCAAGGTGCTGCCAGCAACGCCG
ACAATGACGTCGTTTCCGAGCAATCTCCGGCTGGTGCGTGGGTCGATGGGCGGAGGAGGTGGTGGCCGAAGCAGTCTCGG
CCACTTCAACGAGGGTATGCCCATGGGCCGGCCTCCCAGCTCGCCGAATCCCTTTTCGTTTGGCAGCAGCAGCAGCGGTG
GCGGCACGCCGGTGATGTTTGCCAAGCGCAAGCGCAACATTTTCAAAGGGCCGATGCTGGCGTTTGGGGGTGGAAGCAGT
GCAGGTGGAGGTGGTAGTGGTGGTGGTCTTGGTGGTGCTGGGATCGGCATCAGCAGCGGTGTTCGGATCAGCGGCGGTAT
CGGCAGCAGCATCGGGCTTGGTCTCGCAGCAGCTGGTGGCGGATCGCATTCGCGCAGCGCATCGGCCAGCGGACTCGCAC
GGCTATCGGGCGAGATCACAATTGCCGAAGAAGATGAGGAGGACGGCGATCTCGACGGCCTGGACGACGGCGAGGGCGAC
GGGGTTGAGGAGGTTGACGTCTTCACGCCAGTCGTGCAGCGACCGGGCGAGCTGGTCGAGGAGATTTACGAGGATGACGA
GGAGGAGAGGACGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62