GenePrediction:GLEAN_1360 Details

Name: GLEAN_1360
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:48145..49657 (+ strand)
Length: 1513
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:48145..48303 (+ strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_168:48386..48513 (+ strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_168:48881..48970 (+ strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_168:49022..49370 (+ strand)
Length: 349
Type: CDS
Source: GLEAN
Position: GCSC_168:49424..49657 (+ strand)
Length: 234
>GLEAN_1360 class=GenePrediction position=GCSC_168:48145..49657 (+ strand)
ATGGTTGATATAAACACCTCTGAGGCATCAGAGCAATCAACACCCGCGATCAATCCTGTCGACGTACTTGCCGTCACTGC
TGCCGCAACAGATACCACAGAACTCACCTCCGGCCGCAACGAGCTTCAACCAGGGAACCACTGGAATAGCCAAAATTTTG
TCGAAGTCAGCCAAATCTTATGAAAAGCCGTGCACATAATATGCGCCACTGACAATTTGTTTCTAATACTGATTGTCTTA
GGACGACGCCGATTCTGCACATGGCCACGACGCGGAAAGTTCTACTGCGTCCATCTCATCCACTATTCTCAAATATCGGA
CCGTAAATGGAAGGACTTACCACAGCGACATAGCAACAAACCAATACTGGTATGTTCCTTTCAATATGCCTCCAAGTCTG
TTCTAGGCTAACTCTAGCAAGGGGTGCAAATGATGAACAACAGAGCAATGCGCTGGACATTCAGTACGCTTGAAAATATG
GAGGTCTTGTGTGTTATGTAGTTGTACTAACAGCTTTTTAGGCACCATGTATTTAGCCTGATGTTGGACGACAAGCTTTA
CCTCGCACCCTTACCAAAAAAGCTTAACGTAAGCTGTATGGATATTGTGTCAGTATGTGTACCTTGGAGCTAACACACTA
TAGAAAGTGCTAGATATTGGAACTGGGACGGGGATTTGGGCTATGTAGGCAACGTTTCTATCGGTTGACTGTTAACAGGA
ACTAACATAGACTTAGTGACTTTGCGGACGAGCACCCTGAGGCTGTAGTGATTGGGACCGACCTATCTCCTATTCAGCCG
AAATGGGTGCCTCCCAATGTGCGCTTGTAAGATATATGTACTCGGATGTTATATGACTTACAACTAACATGGAACAGCGA
AATCGAGGACTTGACACAGTCGTGGACATTCGAAGAGAATTCTATAGACTACGTCCACATGCGCTGGCTGATTGGATGTG
TGTCGGATTGGACCGTTCTGTTCAAAGAGGCCTACCGAGTCCTTAAGCCGGGTGGGTGGATTGAAACATATGAGTCCGAC
GGCATCTTGGAGTCCGACGATGGCACCGTAACAGAGAAGTCCGCCACCGGCCAGTGGGGTCACATCTTTCGCGAGGGCGC
CAAGAAGATGGGCTCCAAGGCCTCATTCAGCGTGGTCGCTGATCATGTGCAAAAGGCCAGCTTGGTTGAGGCGGGCTTCA
CCAGCATTAACGAGTTCCCGCTTAAGGTGTGTTAGCTTCCCTTAGCTCTTTCTGCTCTCAGTTAGCTAACAGCAGAAAGA
CTCCTATTTCCGAGTGGTCAGAAACTCCCAAATTGAAAGAAGTCGGCCAATTTTCCCGGGCTGTGTGGGAATCCGACACC
CGCGGCTTGATGGGCTACAATGCGAACTTACTTGGCTGGTCCTCGGAAGAGCTTACTGTATACTGCGCCCAGCTTCGCCG
GGAGATGCGCGGCTTGAAGGTACATGCTTACTACAAGTCTAACGTAGTATGGGCTCAGAAGCCCCATGCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62