GenePrediction:GLEAN_1362 Details

Name: GLEAN_1362
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:58654..59998 (+ strand)
Length: 1345
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:58654..58769 (+ strand)
Length: 116
Type: CDS
Source: GLEAN
Position: GCSC_168:58871..58949 (+ strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_168:59006..59998 (+ strand)
Length: 993
>GLEAN_1362 class=GenePrediction position=GCSC_168:58654..59998 (+ strand)
ATGGCCAGCTTCTTCGATCTCAAGGCGCGCAAACTCGCGGCAGCTAATGGCACCGCCAGCAAGAACGACAAGCAGACGAA
CGAGACGTCTCGAGCACAGCCTTGGGTTGAAAAATAGTGAGTAGGAGGAAGAGGAAGAGGATGAGGACAGAGAGTTTGGA
CAGCACAAAACTGGGGACGAGAGAGACACGACAGAAACATGCACTGACGGGATGCAGCCGGCCAAAGACGCTCAGCGACG
TCACTGCTCAGGACCACACTGTGACAGTGCTACAGCGAACACTGCAGGCTTCCAATGTGCGTTTTCGCCCTGCTGTCGTT
CTTTGCACACACGATCTGACGAAATATATCAGCTCCCGCACATGCTCTTTTACGGGCCGCCGGGCACGGGCAAGACGTCG
ACAATTCTAGCGCTGGCCAAGGAGCTGTACGGTCCCGAATTTGTCAAGTCGAGAGTACTGGAGCTGAACGCGTCGGACGA
GCGTGGTATCTCGATCGTGCGGGAAAAGGTCAAGGACTTTGCGCGGATGCAGCTGACGAACCCGCCGCCGGGCTACCGCG
ACCGATATCCGTGCCCGCCCTTCAAGCTGATCGTGCTGGACGAGGCCGATTCGATGACGCAGGACGCGCAGAGCGCGCTG
CGCCGGACGATGGAGACCTATAGCAAGATCACGCGCTTCTGCCTCATCTGCAACTACGTCACGCGCATCATCGACCCGCT
GGCCAGTCGCTGCAGCAAGTTCCGCTTCAAAAGCCTCGACCAGGGCAATGCCCGTGCCCGCGTCGAAGACATTGCCACGC
GCGAGCACGTGTCGCTGGCTCCAGGTGCTGTGGACGCGCTGATCCGCTGCAGTGAGGGCGATCTGCGCAAAGCCATTACG
TTTTTGCAGAGCGCCGCCCGGCTAGTTGGCCAGGAGGAGGAGGACAAGAAGGAGCAGAAGGAACAGAAGGAACAGAAGGA
TCAAGACAAGGAAGAAGACAGCATGGATGTCGATGACAGCCGGCCGGCCATCACAGTCCAGATCGTCGAGGAAATCGCCG
GCGTCATCCCCGACGATGTCATCAGCCAGCTTGTGCAGGCGATCCGGCCAGCAGCCAAAGGCGGATCGACCTACGCGGCA
ATTGCGAGCGTGGTCGAGGACATGGTGGCCGACGGCTGGAGCGCCGGTCAGGTGGTCACACAGCTGTACCAGACCGTTGT
GTACGACGAGACGGTGCCAGACGCCCAGAAAAACAAGATCGTGCTGGTGTTCTCCGAGGTGGACAAGCGGCTGGTCGACG
GTGCCGACGAGCACTTGTCGATCCTGGACCTGGCGCTGCGGATTTCAGCCATCATGGCCAAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62