GenePrediction:GLEAN_1363 Details

Name: GLEAN_1363
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:62484..72491 (+ strand)
Length: 10008
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:62484..68798 (+ strand)
Length: 6315
Type: CDS
Source: GLEAN
Position: GCSC_168:68916..69422 (+ strand)
Length: 507
Type: CDS
Source: GLEAN
Position: GCSC_168:70569..71194 (+ strand)
Length: 626
Type: CDS
Source: GLEAN
Position: GCSC_168:71278..71812 (+ strand)
Length: 535
Type: CDS
Source: GLEAN
Position: GCSC_168:71873..72406 (+ strand)
Length: 534
Type: CDS
Source: GLEAN
Position: GCSC_168:72465..72491 (+ strand)
Length: 27
>GLEAN_1363 class=GenePrediction position=GCSC_168:62484..72491 (+ strand)
ATGTCTTCCAACTATAACCGCGATGTGTCGCAGTACAAGTACTCGGCCATGTCCAACCTGGTTCTCCAGGCGGACCGCCG
TTTCGTCTCGCGCCGGAAGGACGAGCCCTCGGGCGACCCCGAGTCCATGGCCGGGCGGCTGAAGATCCAGGACATGGGCT
CGCGTATTGCCCGGGACAGCGCGCCAAAAACAAAAAAGACGTCGGCGATGCCAGACGTCAAGCGAGGAGACTTCCGGGAG
GGCGAGGACGTGCTTCTGCGCGAGCAGCGGAAACGACAGGGCCAGACAGCTCTGCACGGCACATCCATCCTGGGCGGAGC
GGATCTGCTGGTGGACGGACTGCGGTATCGGCCACGAACATCGGCAACGCGGTCGACGTTTGAGCTGATCCTCTCGCTCG
TAGCCAAGAACCTGGGCGACGTGCCGCATGAAGTAGTGCGCAGTGCAGCGGACGCGGTGCTCGAGTACCTCAAGGACCCA
AGGTTTGATAAGAAGCGGGAGGTGGACGACATCCTGGGCGTGAGCCTGAACGCGAAGGAGTTCAACGAACTGATGAACCT
GGGCAAAAAGATCACCGACTACGACAACCAGGAGGACGAGGACCAGGAGATGGCCGACGGCGCCGGCGCCAACGACGACG
AGGAGATTGACGACCGGCAGGGCGTGGCCGTCGACTTTGAGGAGGACGACGACGAGGACGCGATCGTAAACGAGGTGCGC
GACGAGTCGTCGGAAGACGAGGAGGACGAGGAGGACCGGCCAGAGATCGCAGAGGAGGCAGCCGCGGGCGAAGCTGGCGC
AGACCGCGACGAGGAGGAGCTCGGGTTTGCCGACGACGGCGACGCCATCCTGATCGACCCGTCTGCGTCAGCATCAGCAG
GCGCAGGTGCCGACAGCAAGAGCAAGCGACAAGGAGGAGGCGGCAGCGGCAAGGTCGACAACGCAGTGGCAGCGCGCGAC
ATTGACGCCTACTGGCTGCAGCGACAGATCGGCCGGCTCTACCCGGACGCACATACGCAGCACGACAAGACGCAGGAGGC
GCTACGGATCCTGGCGGGCGAGCCGGACGAGGCGGGCGGCGCAGAAAAGGAGCTGCACGAGATCGAGAACGAGATGATGG
AGCTATTCGATTACGAACACCCAGAAGTGGCACAGAAGCTGATCGACAACCGCGAGAAGATTGTGTGGCTGACCAAGCTG
GCCCGCGCGGAGAGCGACGAGGAGCGCGGGGTGATCGAGCGCGAGATGGCATCAGAGGGCCTGCAGTGGATCCTCAACGA
GCTGCAGGGCAAGACAGGAGGAGCGGACGCGTCCAAGAGGGGCAAGATGGAGATCAAGATGGACGTGGACTCGGGCGCAG
CGGCCGTGCTGGCCGGCGATACAGCCAAGGCCGAAGAGGGCAAAGAGGTCAAGGAGGGCGGCGGCCTGGTCGGCGGGCTG
CAGCCGCGCAAGACGATCAACCTGGAGAACCTCGTGTTTGAGCAGGGCAACCACCTGATGACGAACCCGCGAGTCTCGCT
GCCGGAAGGGTCGACAAAGCGGGTATTCAAGGGCTACGAGGAGATCCACGTGCCGCCACCGAAGAAGCGCAGCGACAGCA
AGGAGAGCAACATTCCGGTGACGGAGATGCCGGAATGGGCACGAGGCCCGTTCAGCACGACCAAGACGCTCAACCGAATC
CAGTCGCGGTGTTACCCATCGGCGTTTGAGGGCGACGGCAACCTGCTGGTGTGCGCACCAACGGGCAGTGGCAAGACGAA
CGTGTCGATGCTGACGATCCTGCGGGAGATTGGCAAGAACCGAGACCCGGAGACGGGCGAGATCGACCTGGACGCGTTCA
AGATTGTGTACATTGCCCCGCTCAAGGCGCTGGTGCAGGAGCAGGTCGGCAACTTTAGCAAGCGACTGGAGCCGTTTGGG
GTTTCAGTGCGCGAGCTGACGGGCGACCGGCAGTTGACGAAGCAGCAGATCGCAGAGACACAGGTGATTGTGACGACGCC
GGAGAAGTGGGACGTGATCACGCGCAAGGCGACGGACCTGTCGTACACGCGATTGGTGCGACTAATCATCATCGACGAGA
TCCATCTGCTGCACGACGACCGTGGCCCGGTGTTGGAGAGCATCGTCAGCCGGACTTTGCGGCGAACCGAGCAGACAGGT
GAGGCGGTACGGCTGGTCGGGCTGTCGGCGACGCTGCCCAACTACCGCGACGTGGGCAGCTTCCTGCGGGTGGACGCAAC
CAAGGACCTCTTCCACTTTGACGGGTCGTACCGGCCGTGTCCGCTGCGGCAGGAGTTTATCGGCGTGACGGAGCGGAAGC
CGATCAAGCAGCTCAAGGCGATGAACGACATTACATACGCCAAGGTTCTGGAACACGTGGGCCAACACCGCAACCAGATG
CTAATCTTTGTGCACTCGCGCAAGGACACGGCCAAGACGGCACGACACATCCGCGACCGGGCCGTGGAGCTGGAGACGAT
CAGCCAAATCCTCAAGCACGACGCAGGCAGCACAGAGGTGTTGCGTGAGGCGGCCGAGCAAGCCACCGACCGGGAGCTCA
AGGACCTGCTGCCATACGGCTTCGGCATCCACCACGCCGGCATGAGCCGGGCTGACCGGACAGACGTGGAGGACCTCTTC
GCACAAGGCGCGATTCAGGTGCTGTGCTGCACAGCGACGCTGGCGTGGGGCGTTAACCTGCCAGCGCACACGGTCATCAT
CAAGGGGACGCAAGTGTACTCGCCCGAAAAGGGCAGCTGGGTGGAGCTGAGCCCACAGGACGTGCTGCAGATGCTGGGCC
GGGCTGGGCGGCCGCAGTTCGACACGTACGGCGAGGGCATCATCATCACAGCGCACACGGAGCTGCCATACTACCTCTCG
CTGCTCAACCAGCAGCTGCCGATCGAAAGCCAGCTGGTCAGCCGGCTGGCCGACAGCCTCAACGCAGAGGTGGTGCTGGG
CAACGTGCGGTCACGTGACGAGGCAGTAGAGTGGCTGGGGTACACGTACCTGTTTGTGCGCATGCTACGGGCGCCGGGAC
TGTACCAGGTCGGGGCCGAGTACGAAGCAGACGAGGCGCTGGAGCAGAAGCGGGTGGACCTGGCACACGCGGCGGCGGTG
GTGCTGCGACGCGCCGGGCTGGTGCGGTACGACGAGAAGACGGGCCGGCTGCAGGCGACGGAGCTGGGGCGAATTGCGTC
GCACTACTACGTCACGCACGGGTCGATGGAGACATACAACAGTCTGGTGCAGCCGGGCGTGACGGCGATCGAGCTGATGC
GCATCTTTGCGCTGAGCGCGGAGTTCCGATACATCCCGGTGCGACAGGAAGAAAAGCTGGAGCTGGCACGACTGCTGGGC
CAAGTGCCGATCCCGGTCAAGGAGAGTGTGGAAGAGGCGCACGCCAAGGTGAATGTGCTGCTGCAGGCGTACATCTCGCG
GCTGCGGCTGGACGGACTGGCGCTGATGGCGGACATGGTGTACGTGACGCAGTCGGCCGGACGGATCCTGCGGGCCATCT
TCGAGATTGCGCTGAAGAAGGGATGGGCAGGCGTGGCACGAACGGCGCTGGAGCTGTGCAAGATGGCAGAGAAGCGGATG
TGGCCGACGATGACGCCGCTACGGCAGTTTGCGAGCTGTCCACGCGATGTGGTGTCCAAGGCCGAGCGCATCGACGTGCC
GTGGCCGAACTACTTCGACCTAGACCCTCCACGGATGGGCGAGCTGTTGGGACTGCCGCGAGCAGGCGCCGGTGCGGCAG
TATGCCGGCTGGTGAGCAAGTTCCCGCGGCTGCAGCTACAGGCACAGGTGCTGCCGGTGACACGGTCGCTGATGCGGATC
AGCCTGACAATCACGCCGCGGTTCGTCTGGGACGAAGAGGTGCACGGGCTGGCCGAGGCGTTCTGGATCGTGGTGGAGGA
CGGCGACGGCGAGGAGATCCTGTTCCACGACCAGTTCCTGCTGCGGCGAGAGTATGTCGGGACGGCCGAAGGGGGCGAGG
GCGCCGGAGAAGGCGAGAACGAGCACGTGGTGGAGCTGACGGTGCCGATTGCCGACCCGCTGCCACCAAACTACTTTGTG
TCGGTGGTGTCGGACCGATGGATGCACGCAGAGACACGACTGGCGCTGCCGTTCCACAAGCTGATCCTGCCCGACCGATT
TCCACCACACACGGAGCTGCTGGACCTGCAGCCGCTGCCGGTATCGCTGTCAGCGCTTAAATCGGCCGAGCACGTGGCGC
TGTACCAGCCGTGGACACACTTCAACCGGATCCAAACGCAGACGTTCAGCTCGCTCTTCTCGACGGACCAGAACGTGCTG
GTGGGCGCGGCCACGGGCAGCGGCAAGACGGTGTGTGCCGAGTTTGCCCTGCTGCGGCTGTGGTCGGGCGGCAACGGTAG
TGGTCGAGCAGTGTACGTGGCCCCCCTGCAGGAGCTGGTCGACGTCCGTTTCGAGCACTGGGAGCGGCGGTTCGGCGACA
TTGGTGGCGGCAAGACGGTGGCCAAGCTGACGGGCGACGTGACGATGGACCTCAAGCTGCTGGCGCAGACGGACCTGGTA
CTGGCCACACCGGCCCAATGGGATGCGCTGGCACGGGACTGGCCTCGACGCAAGACAGTGCAGACGGTGCAGCTGTTCAT
CGCAGACGACCTGCACATGATTGGCAGCAGTGCGGCCAGCGGCCACGTGTACGAGGTGCTGGTGTCGCGGATGGCACATA
TGCGGCAACAGCTGGCGGCCAAGCAGGCAACGACAGCGGCAGCACGGTTGCGGATCGTGGCGCTCTGCGTGTCGATGGCA
AATGCGCGCGAAATGGGCGACTGGATCGGAGCGGCCAAGCACGACACATACAACTTCAGCCCGCAGGTGCGGCCGGTGCC
GCTGGAGCTGCACCTGCAGTCATACACGGTGCCACACTTCCCGTCGCTGATGCTGGCGATGGCGAAGCCGGCCTTCTTGG
CCATCACGCAGCTGTCGGCAGCGCAGCCAGCGCTCGTGTTCGTGCCATCACGAAAACAGACGCGGGCAACGGCACGTGAC
CTACTGCTAGCGTGTGTGGCCGCAGCCTCAGAGGGCGGAGCCGACGGTGACGAGGACCGGTTTCTGCACGTGGACCCGGC
GCAGCTGGGGCCACTGCTGGAGCGGGTGCAGGAGCCGGCACTGCGCGAGGCGCTGTCGCACGGGGTGGCCTACTACCACG
AGGCGCTGAGCGCGACGGACAAGCGGATCGCACGACACCTCTTCGCCAACGGAGCCGTTCAGGTGATGGTGGCGTCACGT
GACGTGTGCTGGGAGCTAGCACGCGACGACTGCACGGCACACCTGGTGGTGGTGATGGGGACGCAGCAGTATGACGGGCG
CGAGCACCGGTACGTAGACTACGCGCTGGCCGAGCTGCTGCAGATGTTCGGGCGGGCACTGCGGCCGGCCAAAGAGGGCG
CCGGAGCGGGACGGAGCCGCGGCGTGCTGATGCTGCCGGCGGTCAAGCGGGACTACTACAAGAAGTTTCTGAACGAGGCG
CTGCCGGTGGAGTCACTGCTGCACGACAACCTGGCGGACGCATTCATGGCGGAGGTGAGCGTGCGGGCGATCCGGTCGGG
CGACGACGCGCTGGAATGGCTGACCCGGACCTTTTTCTACCGGCGACTGCTGGCGAACCCGAGCTACTACAGTCTCGGGA
GCCGATCAGAGGACGCGGTCGGACAGTTTCTGACGGCGCTGGTGGAGGACACGCTGCTGGAGCTGCGGGAGACGAAGCTG
GTGGAGATTGACGACGACGACGACGACGAGGACGCAGAAACCGAGGGGGCGATCCGGCCGCAAAACGGCGCCTCCGTGGC
GACGTACTACGGGCTCTCGTACGTGACGATGCAGACGCTGCTGCTCTCGCTGACGGCGCGGACGCGGCTCAAGGGCATGC
TCGAGATCGTGACGGCGGCGGCCGAGTTCGAGACGCTGCTGCAGACCCGTCGCCACGAAGAGCGGCTGCTGCAGCGCATC
TACGACCGGGTGCCGGTCAAGCTGGCGGCCGCACCGACGACGGCCGACGAATGGGCCGCGCCAGCCTTCAAGGCGTTCGT
CCTGCTGCAGGCACACTTTGCGCGCATGCAGCTGCCGGTCGACCTGGCACGCGACCAGGAAGTCGTGGTGGCCCGCGTGC
CGGCGCTTCTGAGCGCGACAGCCGACCTGCTCGCATCACAGGGCCACCTCAACGCGCTGCAGGCCATGGAGATGACACAG
ATGGTGGTGCAGGCCATGTGGGACCGGGACAGCCCGCTGAAGCAGATCCCACACTTTACGCCAGAGGTGATCAAGGTGGC
AACGCGATATGGGTGAGTTTTTTTGTTGGTTTTTTGTTGTTGTTTTCTTTTTTCTTTTTTTTTTTTCTTTTTTTTCCCTT
CCCTCCACTTCTCTAACTCCCACAGCATCAAGGACGTCTTTGACTTTATCGACAAGATGAACCCCGAGGAAAATAAGCAG
TACGCCGACCTGGTCCGCGACCTCGGCCTGACCCAGGCTCAGCTGGTCGAGGCCGCTCACTTCACCAACGACAAGTACCC
AGACATCACGCTCGACTTTGAGGTCGAGGATGCCGATGAGCTGCGGGCGGGCGAGCCGATGACGCTCAAGATCAAGCTGG
AGCGCGAGGGCGGCGACGAATCGGACGAGGAGGACGAGGCCGAAGCCGAGACAGACGACGACCTCTCCGTCCACGCGCCC
TTCTTTCCCGGCCGCCGCCTCGAGCGCTGGTGGCTCGTCGTCGGCGAGGAGCGCACCAAGTCGCTGCTCGCCATCAAGCG
CACGTTTGTCGGCCGCCGCAAGCCGGTCGAGCTGCGGCTGCCGGTCGAGCTGCCCGAACCGGGCGAACACACGTTCAAGC
TGTACCTGATGAGCGACAGCTACGTGGGCGTGGACCAGGACCCGTCCTTTACCGTGCAGGTGGCCGAGGGCATGGAGGAG
GACAGCAGCGAGAGCGAGTAGGGGATGAGGGAGAAGGGAAGGAGAGGATGAGAGAAAGGAGACGGAAAGGAAATGGAAAA
GGGAAAAAGACCAAATCAACATGTATGATCAACGGAGTCATTGCTCTGTTCAGTCACGTGCCGCTCATCCCGCCATTCGT
GTGCCTCCCCATAGATGGCGATCGCTCCTGCCTGGCAAACAGCACGATAACGTGACTCTGTCGCCTCGAATCCATGGCCC
CCATCTCCAATCTCCCATCAAAGACTTGTCTGAGAAGACAGCTTTTCCCAGAAACACATCTTGCAGAGTCAATCGCCACT
CTGGGTATGTGACTGTCGTCTGTGTTCTGCTCCGTGCTCTGTCCTCCGTCTCTCCTCTTTCTCCCATCCATGCCCACAAC
AAAGGATATCTAACCAGCTTCTTCGCGATCGGCCACACCCATTTATTCCAGCCTGGTGTCAGTCCGTTTCCCGCCTCTGG
CGTTCATGCCCGATTATGGACTAATCTCATTGATCTGGCTCTCCTGTCTTCTGTTACATTATTGCTGTCTGAATCAGCCT
CCTTCATTTCGCTGCTCGCTTTGGCCGCCACCATCCAACACAGAGTCCTGCCATCGGTTACACCACTCCAGAACACCCGC
AGCTTCGGAACACAGCCCAACACCGCCTCTGACACAACTGCTGCCTCCTGCCAGCCAGGCCCTACAGCTTCGGCGCAAGA
CCAGCGCGCAAGACCTAGGTCGAGTGGAGAACAGCAGGACCCCTGCTCCAAACCAAAGGTATTGGTTGATTGGCCCGTCG
TGGCTATTTTTACTGGATCCCCGGCTCCACTCCGAATCGCAATCCTGGTCCTTTTTCCCGTGTGTCTCTCGCTCTGCTCG
CTGTGTGGCTGTCCCTGGCTCCTCTCTTACGTGCCTTTTTTTTTTTCCCTAACGCTCCTTTCTCGCCCTCTGCACGCGCG
CACCTGCTCTTCCTCCAATCCCCCACGTCACGCGAAGAAAGACGCCTCCCAACCCTTTCCACCGCACCACGCATCCGCAT
TCGCCCGCCGCCACGTCCATCCCCAAGACTGATCCATTCTCTCTCTGGCCTTGACCTCCTGGCTGAAACCAACTCGACGC
TGCAGAAAGAAGCCAACGCCGCCACGATGACGGACGTCGCGGCCGACGCAAAGGCAACAGCGCCTGCTGCTGCCGCTGAG
GAGCCCAAGCTCGCCGACGCGCTAGTCGAAGCTTCTGCTCCGGCTGCCGATGCCGAGACCACTGCCAAGACCGATGGCGA
AGCTGCGGCTGCCGATGCTGATGCCGATGCCAAGCCCACGGACGAGACGCGTGCCGATGGCGCAGCCGAAGCTACCGGTG
AAGCATTTGCTGCGACAGAATCCGACGCGCCGGCCGCCGAGAAAAAGGACGCCGCAGACGAGACGGCGTCTACGCCCGCG
AAAGCCGCCAAGGCGTCAACATCCGCGTCGCGCCGCAAGTCCGTCGGTCAGAAGCTCAACCGCAAGGCCTCCAAGATCCG
GACCACCCACCTCGAAGCCAAGCCCGGCGACCACTACTTTGTCAAGCTCAAGGGCTATCCGGCATGGCCCGTCATCATCT
GCGACGAGGACATGCTGCCCCAGACCCTCGTCAAGTCGCGCCCCGTCTCGGCCGCGCGCCAGGACGGCACGTATCGCGAA
GACTACGCCGACGGTGGCAAGCGTGCTGCCGACCGCACGTTTCCCGTCATGTACTTGTTCACAAACGAATTGTATGCTTC
TGTCTTGCCTTGTTGATGTTTTTTTTTTCTGTTCTTATTTTGTCCTTCTTTGCCTGCTGTACTGACTCTCCCAGCGGCTG
GGTTCCCAACCAGGACATGCACGATCTTGACCCTTCCAAAGTCCTCGAAGCCGTCAATGACAAGATGCGCAAGGACCTGC
AGCATGCTCACAAGCTCGCGGCCGAGAGCAACCCCCTGGGCTACTACAAGGATATGCTGCGGCAGTACCAGGAAGACCTC
GAGCGGGCTGAGGAGGCTAAGCGCCAGGCCCAGGCCACACCGAAGAAGACCAAGAAGGTAGCATACAAAGAGGGGGATGT
CGACATGCTCGATGTGCCGATGGACGATGACGAGGAGGCGGCGGCAGCGTCGAAGAAGGCGAAGAAGCGAAAGGCCGACG
ACGATACCCGAACTCCCCAACGGTCGGACTCGGCCAAGAAGCCGAAGATCAAGATCACATCCTCGGGCACACCCAAGAGC
ACCAACGGCACGCCGACGGCAGCTAAGAGCGCCAAGTCTAAGCCCAAGAATAGCGAGGTCCCGGCTGCCCCGATCACGGT
GCCAGTGGAGGACGAGGTGGCGCCTGAGGAGAAGCTTCGGCGCAAGACTGTCAGTTCTACGTGCCGTGTGCTTGTTCTGT
TTAATGCGGCAGTTCTAACCCCTTGACAGAAAGAGATCTACTTTTTACGGCACAAGATTCAGAACAGTCTCCTGCCACGC
GACCAGGCGCCTATCAAGCCCGACGAGATGAAGCTGACCTCCGACTACCTCACCAAGCTCGAGAGCTTTTCCTCCCTCGA
GGTGGTTATTATCCGCCAGACCAAGATCAACAAGCTGCTCAAGGCCATTCTGAAGATCGAGACCATTCCACGCGAGGAGG
AGTTCAAGTTCAAGCCGCGCTCGCATGCCCTGTTGGACAAGTGGAGCAAGCTGTTGGCAGCACAGCCGGATCCAGAAGCA
GCGGCGGCACGAGGGAACACCAACGGTGCCAGCACAAATGGGCACGCCAAGACGAAGGAGGCCAAGGCCAACGGTGCCAA
GGACGAGAAGGAGGCCAAGGACGGCAAAGACGGCAAAGACAGCAAAGACAGCAAGGCCCCATCTCCGGAGGACGTTGCCG
AGGCGAAGGAGGACAAGGCCAAGACGAGCGAAGTCGATATGGAGTCGGAGCCGCCAAAGGAGATCGAGAAGGCAAAGGAA
GAGGTACGTTTCTGTGTGCCTTGAGCGTGCAGTGCTCTGTTGAGAAGCTGACAAGCCACAGCCCGAGGCCGTCGAGGCAA
CTGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62