GenePrediction:GLEAN_1364 Details

Name: GLEAN_1364
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:73289..75879 (+ strand)
Length: 2591
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:73289..73339 (+ strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_168:73434..74167 (+ strand)
Length: 734
Type: CDS
Source: GLEAN
Position: GCSC_168:74231..74504 (+ strand)
Length: 274
Type: CDS
Source: GLEAN
Position: GCSC_168:74551..75879 (+ strand)
Length: 1329
>GLEAN_1364 class=GenePrediction position=GCSC_168:73289..75879 (+ strand)
ATGGCAACGGCAGCATCCACCGGCAACGGCAGCACCAATGTTGTCCGCAAGGTGAGTGTCTCATCATGAAAAGAGCTATA
AACGGCTATTTGCACTTTGCATCACCGCCCGGCGGCACATCCGACATGCTGACGCATGCGACCAGGTTGCGTACATCTTC
AATCCGTCTGACGATGAGGACGAGGAGGCGGAGGGGGAGAGCAGCGGCGGCCAGCAGCCGGCCACGCCATCCCGTCGTGG
CGGCCGCAAGCATCGTCGCCGAGATAGTGGTGAGCAGGCGACCGGCCGAGCGATGAAGAAGAAGCAGCGGACTGCAGACA
CGGCGAACATGGCGAACACGACGAACACGCTCGAGACCTTTCCGACGCTGCTGCAGGGCCGCGAGACGGCCGAGGCGGTG
GTGCTGCGGCAGCGGCTCTTTGCGGCCACGTGGGCCGATCTGGACGGACGCATCCATGAGGTGCTGCAGCGGTCGAACCG
GGTGACGCTGGACGCCATCACGGACTTTATCGAGCAGCCGAGTGGAACCAAGCTGCCGGCCGCGTTTGTCATCCTGGGGC
CGGCGGCGACGAGCGACATGCTGCTCTTCCGCCAGCTGGCGGCGTCCTCACGGGCAGCAGACGACAGCGAGGCCCGCATC
CGCCGCATGGTGCGGCTACGCGCAGCCGAGGCGCCCAACCTGCGGGCAGCGCTCAAGGCGATCGTGCAAGAGGTGACGGC
CACGGCGGCCGAGACCGACGGCCGAGAAACGTATCTCGCGTACGACCTCGAGGCAGTCTACGCCTTCGTCCGCGGCCGTG
ATGCCCGGATCATCGTCACGTTCGAAGACAGCGAGGCGTTTGACAGCAACATTCTGGCCGATCTCCTGGGCTATCTGCAG
TAGGTCTCTCGTTCGATCTCGTGTCCCTTGTGTCCCTCGCTGACATACATCACCACCACAAGCTCCTGGCTGGACCGCAT
CCCGTTTGTCCTTCTCTTTGGCGTGGCCACCTCGATCGACCTCTTCCAGGCACGTCTGCCCAAGACGGCGGCCCACCGGC
TCGCCGCAGCCCAATTTGATGTGGCGCCGTCGTCGTCGGTGCTGGACCAGCTGGTGCGGCGCGCCGTCGCGGCCGCCAAC
GTGCCGCTACGCATCGGACCCAATCTGCTGCGCAGCCTGGCCGAACGGCAGGACGAGCAGGTCGCCGGCGTGTCTGTCTT
TGTCAACTCGCTCAAGGTACGTGACATTGTCAAGGCAGTCAATCCGTGTCTGACACTAGCAGTATGCGTACATGTGCTAC
TTTTATGCCAACCCGCTGAGCGTGTTTCTGAGCAACGAAGCCTCCACCTTCCTTGAGCAGCAAGACTACGTCGACGCTCT
CCGCGAGCTGCCCTCCTTCCGGCACCATATCGAGAGCTCACTGGGGAGCTGCCCGTCGACCGAGCTGGTGGCGCTCCTCA
CCGACGACGCCGTCTTCCGGCAGAACGTCGCCCGGCAGGCAGACCTTCTTCGGCATTGGACCACGCGGCTGCTGCGGGCC
GTCCACTTGGCATCAGCCAGCGGCGCCTTTGCCGACATGTCCTTTACGGAGCTGTACATTGCCGCGCTCGAGGGCGGAGG
TGGGGGTGGAAGCGGCAGCGGCACGACGACCGAGGATTCCATCGCGGCCACACTCACGGCTGCCATTCGGCGCATGTCGT
CCGCCGAGCTGGTGGCCCTGGCGCGACGACTGGCCGAGGCTGTCCGGAGCGGTGATGAGGAGCTAGCACTGGTACCGGCA
GCCGAGGAGGAGGACACCGACAGCTGGAGCACGCTGGCACCAAAGCTAATCAAGATTGCAGACGAGGTCGAGGCCCTGCA
GCGCAAGGTCGAGGCCAGCGGCGGCCAGAGCCGAATGCGGGGCGGTGGCAGCAAGACCACGCAGCTGCGCAGCCGATACA
CGGCGCAGAGCAAGGTGCTGCGGACGACGGTGGTGGCCCAAAAGGTGCAGCTGAGCCGCGACTCGGCCGCGCTCACGGCA
GAGGACCAGGCCTTTACAGAGCTGGTGGACCGGACAGCCGACCTGGTGGTGGCCGAGATGGACGCCGAGGCAGCAGAGCC
GCGGGAGGCGAGAGGCGCGAGAGAGGCCAAACCAGCAACGCCACCGGCCTCTGCCCTCTGGCTGCAGGAGGTCTGGCTGT
ACGATGCCCGGACGCCGTATCGGGACGTGTTCATTCCACGGCCGGTGCTGGTGCTGGAGCGGGCACTGTCGCGGCCGCAC
GACTATCTCGCCTGCCAGTGCTGCGGCGGAGACGAGTCCCGGAAGCGGGCAGAGCGGTCCGGCGCCGGAAGCATCCGGCC
AACGCTGCCGCCGACGGCCATCCTGTACCAGCTCTACCGTGAGGCTGGCACGCTGATCAACGTGGCCGATCTCTGGGCGG
CCTTCCAGATGGCCGTGAGCAGCAGCGGCGGCGGCGGCGGCGAGGCCGAGGAGACAGAAGGCGGGGCGGATGAGAGGGAA
CGCCGGCTTCTGGTGCAGTTCTACCACGGCCTGGCCGAGCTCAAGGCTCTGGGCTTTGTCAAAGCAACAAGGAAAAAGGT
GGATCACGTGGCCAAGGTGAAGTGGTTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62