GenePrediction:GLEAN_1366 Details

Name: GLEAN_1366
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:79060..81459 (+ strand)
Length: 2400
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:79060..79143 (+ strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_168:79206..79333 (+ strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_168:79395..80907 (+ strand)
Length: 1513
Type: CDS
Source: GLEAN
Position: GCSC_168:80971..81082 (+ strand)
Length: 112
Type: CDS
Source: GLEAN
Position: GCSC_168:81347..81459 (+ strand)
Length: 113
>GLEAN_1366 class=GenePrediction position=GCSC_168:79060..81459 (+ strand)
ATGTTGTTGCGCTTTCGTGGCCCCGACGGCATGATCCGTCAGGAGGCCAGTAAAGACGACACCTTTGGCGACATTATGCT
CAAGGTGAGCGCGCTCGACAAGCTTCTCCCTGCTGCAGCTCTGCTGACGATGTCTCCAAAACGCAGCTGCTGCCACAGCT
TCCATCTACTGTCGATCCTCGAACTATCACGGTCTCCAACAGCCCCGGAAGCCGTGGTGACAGGAAGAAGGTAGCTGAGG
TGGCGAATGTCCTCATCAGCCAGATAGGACTTAGGTATGTACATCCGCCGTCGCGATAGTCGTACTGACCGTCGTCTTGT
ACTGACCGGCTATAGTCACGGTGACATGGTCTTTCTCGAATACAAGCACAAAGAGGACGGCGCAAATGGCGACTCCAACG
ACGACTCGAACACGTCCCAGACGATCACATCCTCCACCAATCGACTGAACGGTAAGCCCGTGCTCGCGGTCGAAGACCGG
CCGATCGACCCGTCCGGCTCCAGCTCAGCATCGACAGCCCTGACGGCTGCGCACATACGGAACGCGTGGGAGGCAGTGAA
ACAATCGAATCTGGACGACAAGCTGGACAAGAAGGACGGCAAGATCACGCGGAAGCGGGACGCAAAGATGTGCCGGCACG
GGCCCAAGGGCATGTGCGACTACTGCCAGCCGCTCGACCCCTACGACGCGACGTATCTGGCCGAGCACAAGATCAAGTAC
CTCTCGTTTCACTCGTATCTGCGCAAGGTCAACTCGGACAAGAACCGGCCGGAGCTGGGGGCATCGTTCATCCCGCCGCT
GGTGGAGCCGTTCCACCGGGTGCGGCCGGACTGTCCGTCGGGGCACCCGCTGTGGCCCGAGGGCATCTGCAGCAAGTGCC
AGCCCAGCGCGATCTCGCTGCAGCCACAGACGTTCCGGATGGTGGACCACGTGGAGTTTGCGTCGCCGACAATCGTGGAC
ACGTTTATCAATGCGTGGCGCAAGAGCGGATCGCAGCGCTTCGGCTACCTGTATGGGCGCCTGGACGAGTACGACGAGGT
GCCGCTGGGTGTCAAGGCGGTGGTGGAGGCCATTTACGAGCCGCCGCAGACGGACGAGCTGGACGGACTGACGCTAGACG
CGTGGAGCCAGGAGCAGGCGGTCGACGGGGTGGCGCGGCTGTGCGGACTCGAGAAGCTGGGGGTGGTGTGGACAGACCTG
ACAGACGCGGGGGCCGGCGACGGGACGGTGGTGTGCAAGCGGCACGCCGATTCCTACTACCTCTCCTCGCTCGAGGTCGT
CTTTGCGGCGCGGCTGCAGGCCCAGCACCCCAAGGCGAGCCGGTGGAGCGACACGGGTCGGTTTGGGTCGGACTTTGTCA
CCTGCTTGATCTCGGGCAACGAGGCGGGCGAGATTGGGATCGCAGCCTACCAGATGTCCAACGAGGCGGTGGAGATGGTG
CGTGCCGACATTGTGGAGCCATCGGCCGAGCCGGAGACGATGCTGGTGCGCGCCGAGGAGGAGGACGACGGGGCAAGCAG
CCGGACGCGCTACATTCCCGAGGTCTTTTACCGCCATATCAACGAGTACGGTGCCAACGTGCAGGAGAACGCGAAGCCAG
CCTTCCCGGTTGAGTACCTCTTTGTCACGCTGACGCACGGCTTCCCGGACCAGGCGCGGCCGCTGTTCACCGACAACCTC
GCCGGCTTCCCGATCGAGAACCGAGAGCACATTGGCGAGAGCCAGGAGCACACGGCCGTGGCTCGCACGCTCAAGGCTAC
GTCCGGTGGCCAGACGACCGACGGCGACCTGAGCGTGTCCAACTTTCACCTGCTGTGCGCGCTGCACCAGATGGAAGTTC
TGTCCAAGGTGAGTGTGTGTGTGTGTGTGTGTGGTGCTGGGCTTGTCTAACTTGGGCGCTAACTGTCCCAGGACGAAGAA
TCACTACTCTGCCGCGTGGCAACGCAACACGACCTGGCCGACAAGTTTCAGCTGCAGGCCACACCCGGCTGGCAGACCTT
GATGATGATTCTGCAATCTGCCGGTGAGCGCATTCCCAAACGCACGAGGGGAGAAATGGAGGGCAGTGGCAGTGGCAGTG
GCAGTGGCCGTCGACAGAGCAGTGGCAGTGGCCGCAGACGCGACGGTGGCGATGTTGATGGTAGTGGCAGCAGTGGTTGC
AGTGGAGGTGGTGGTGGTGGTGGTGGTGGTGCTTCTGTGGTCGATGATGCCACAGCCCCTGTCCCTCTGATCTCCTCTTC
CTCTTCCTCGTCTTCCTCAGCCACATCTGTTTCCACCCCCTTATCAGGCCGTGATTCCGGGTCAGGCGAACCACTTGCTA
AAAGATTTGCTGCCGTTAGGCTGAATGCGCGAAGTCTGCGGCCAGACTCGCCCTCCCAACGACCGACGGACGGCGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62