GenePrediction:GLEAN_1367 Details

Name: GLEAN_1367
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:88083..89229 (+ strand)
Length: 1147
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:88083..88354 (+ strand)
Length: 272
Type: CDS
Source: GLEAN
Position: GCSC_168:88455..89229 (+ strand)
Length: 775
>GLEAN_1367 class=GenePrediction position=GCSC_168:88083..89229 (+ strand)
ATGGACGACAACGGCAGCAGTAGCAGAAGTGCTCGGCCGTCCCACCATGTCCCGCAGACACGTCCCCCGCGTCCACAGCG
GCCGCCACGATCCAGGCGGTCTCAGCAGCCTCGACGACCACGCGAGCGGACAGCAATCCTGCCGCAACGGTCGGCATCGG
TGATGCGCAAGGTGCGAGCCGGGCTCTCCAAGAAGCTCAAGTTCTTCACCGAGCTGATGGGACAGCTGGATATGATCGTC
TATGCGGAGCTGTGCACGCTCTACTACATGGAGTGAGTTTGTTTTTGTTTCTTGTTCTGGCTCACAGCTGACGTGCAGGT
GCTCCTTTTTTCGGCTTCTCCTCCGAGCCATCCCACAGTCGCTCTTCCTCAGCCCCAAACCGGACGAGTTCATGCTGATT
ACGCCGGCCCACCGGCCCCACGTGCTCGCGGTGGTGGTGCCGAACGCGCTCTGCATGCTGGCACACGTGCTGTGGCAGCC
GCTGCAGGGCACGGAAACGTCGCGCGGCTACCTGCATGGCGGCGTGTTGATCGACTTTGTGGGCCAGCGGGCGCCGTCGT
CGCGCTGGGTGCTGTTTCTACTGGACCTCGTCGTGTTGGCCGTGCAGTGCCTGATGCTGGCCGTGCACACGGAGCGGGAA
AAACTGCGCAAGCTGGTGCTGCCGATGAAGGGCGCGCTGGCGCTGCCAATGGGCCGCGACCTGGCGAGTCCGGCTCTGGC
GGCCACGACGAACGCGATGGTGGCGGCGGCGCAGGACCACGATGCCGAGGAGCGCGGCGTGCAGAGGACGACGGGACGTC
CAGCCGAGGGGGGCGATGGGATCGAGATGCAGCGGTTGGGTGGTGGCGATGCAACAACCGAAAACAACGGAATCGAAAAC
GAAAACGAAAACGAAAATGCTCTTCTCGATGATCGGCCCCGAAGACTCCCGCCCGAGCAGGCAGCAGAATACGTGCTCAA
CGCGCTGGCATCGGGCTGCAACCTCTCCGACTTTTACGTGGTCCACGCCATCCGCGAGGCCAGCCAGGACTACCAGGGCG
TAGCAGCGCAGTCGCTGCAGACAATGAGTTATGCGGCATCGCTGGCGAGGCTGGCAGCGCGGAGAGGAGGCGCCGGTGTG
CGGACGCAGACGACAGGAGTGCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62