GenePrediction:GLEAN_1371 Details

Name: GLEAN_1371
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:101670..107224 (+ strand)
Length: 5555
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:101670..101995 (+ strand)
Length: 326
Type: CDS
Source: GLEAN
Position: GCSC_168:102392..102676 (+ strand)
Length: 285
Type: CDS
Source: GLEAN
Position: GCSC_168:102859..107224 (+ strand)
Length: 4366
>GLEAN_1371 class=GenePrediction position=GCSC_168:101670..107224 (+ strand)
ATGTCGCAGCTCACGCCCCAGAGCAGCCAAGGCTCTGCAGACTCCGCACATATCGATCTGCAACACCGACAGCACGATTA
CCACTCGTGGCAGCAGCAGCAGCGCATGCACAACCAGCAAACTAATCTACCCGCGTCTCCTTCCTCTCCCACTCTGCCTT
CTTCAGCCTCCTTTTCTTCGACCTCCTCCTTTTCGTCTCCTTCCCCCACGCAACGTTCCCGCGACGGCAGAGGAAGTCCG
CAGCATACTTACCGCCAGTCTTATGGACCCAGCTCTTCGGCCCTCTTGCAAACCAGCCTCAGCAGCTCTGCGCCGCTCTC
TTCAAGGTAAGCTCGGTATCCCCTCTCGTCTGCTTACAACACAACACTCCTTCTGTACTCCGTATGCATCAGCCCCTGGT
CGTGACTGCACAGCAGACTTGCTTATCTGTCTGCTTTCTGCCACTTCCCCATCCGCCCTGTAATCCCTTCTGTTGTACGA
CTCTTGCCTTCATCAATCTGCACCATCGTCGCCCAATTGGCCCTCTGTCGTTCGTTTGCACAGGCACAAAAGGACGTGTG
TCTATGTGGGCGCGACAGCAGAGTGTACGACCCACCGGCCAATACCCCTGGTCACTCCTCTCTGGCTCCAGACATCCTGT
TGTGGGACTGGTCAAGACCGTCTGCCCCGTCATCTCTTGCCAGATCCAGCTACTAATCAACCCTTTTGCGCCAACCGTTC
AGATCTCGAAAGGCTGCCCCTAGTCCGCTGCACATGAGCACTGTTGCTCCTTCGACGACCATAAATCCTTCAGCATTCAA
CTTCCCCTTCGCCGCCTCTCCGTCACTGGGCCACCTGCAAGGCGCTGAAGATTCGCGAACCCCCAACGTTGTCCCCCTGA
TCGTCACCTCCTTGCCTAGGCCAGTAGCGGACTCTGCCGACCAGTTTGCAGAGACCGAGAAGACATATTTCGACAGCGCC
TCCTCCGGAGACGCATCACCCACTGGCGAGACAAGCCAGAGTCCAACGTGCGTTCCGTCCCGTCCCGTTGCGCTGTTGTG
TTGTTTTGCTTTCTATTTGGCTGCTTGTGCCACCCCCCGTCTCCCGGCCTCCGGTTGGACCCCCTCCTTCTTGGGCTTTG
TTCGGGCTGCCGCCTTCGTCTTCCTCGCGCGTCGTGCCGGTTCCTCTTTCTAATGATGCCAACTTCCAGAATATCGCCCA
TTTCACCCCGCACTCCGAATGACCATCGAAGCGTCTCTGAATCGGTTGTATCCTCGAAGCCTCTCTCAGGGGCGACCGTC
TCATCTCGGGCAGCCATGGCCGGCTCTTCTGCCACAAGGCATGCTGAAGCCACAAACGGCGTGCCGCGAAACTCGTCCAT
CGATTCTGGCGTGTCTGCTCTCTCTAATGGCTCTGGCCAGCGTAAAGGCTCCACGGACGGTGACGCGACCAGCCATGATA
TTCCTTCCATAATCAAGGCTGCCGGCAGCCCAGAGGCTGTTATCGAGCACCTGCTGAAGGAGAAGCACGCCCAATATCAG
CAGAATGCCCAGCTATGGCGGCTCGTCGACAAGCAGAGGGCAATGATTCTTGGCCTCAACAAGGACCTAGAGCGCGCGCT
CAAGGACAAGGAGAGATATCGGAAGAAGCTAAAAGAGACACTGGCGGGCCAGACCCGGAACCTATCTACTACTCCAGCGT
CATCGTCCACGTTGATACAAGAGCACCGCAGCCGGGCCGTGGACAACGATGAGATGGCGGAAGAGATGGCGGCTCCTACT
GCCGTTGCAGCGAAGACCACTGTTTCCGAATATGCTGAGTCTCCTATCGAACCGACGCCGATCCGCTCACCTGTCGATGT
CAGCATGGCCCCTTATCCCATCACGCCGCCTGCGGATCAGCCTAGCCATGCGCCGTCAACAGTTGCTGGTGATCTATTAG
ACCCGGTCTCCTCAATGCCTCGTCCTCAGGACCACGCCTTGGACAACTTCGACCTTGAAGCTGAGGACCGAGCAGCCGAC
TCGGTTAGGAAAATAGCAAACAGCACTTCTGACCTTCTTATCAACTTCTCTCTGCCACCCTCGCGCAGTCTGCCCAGCAT
TCCACCACAGGTGCCGCCACCACGGATACCACCCCCACCACCGCCCGTGTCTTCTGCCAGTACCAAGGCCATTGACGAGA
GCATCGAGCAGTTTCCGTCACCACCACCACCACCACCACCACCACGGAAAGCGCCACCAGCACCGCTGTTGCTTCGCGAT
TTGCGGGCTAGTCTCAGCGCCCCAATCGACGACGAAGTGCTCGAGTCGGATTCCGACTATGACTCGCTTCTTGAAGTGAC
GGAGATCAGGGAGACCGACAAGCGGGGACGGCGCCGGACGAGAGAGGAAGACGACCGTGAGCGAGAGATCCTGGCAAGAA
AAGAAGCCGAGATACGCAGCTTGTCGAAAAAGAGCAAGCAGAGCAGCAGCGCGCACGACGCTGCTACTAATACCATTTCA
GGCTCCGTATCACAGATCGAAGTCCCGATTATCACACAAACTGTAGTCTTACAGCCTCTGCTGGATCCGACGTCATTGGA
TGGTGTTTTGACCACCGAGCGTGGCGGGCAGTCTCTCTTGAGACGCAATTTCTCCGCCCCCATGCTGAGTCCGGGATTGC
CGTCGAGTCCTCGTCCTGTCGGACACCCGAAATCGCCCATGCATTCGCCCCCAATGTCTCCGCGGTTGGCTCCTGGCTTT
CCTTCTGTCGGACCTGTGCCACTTTCGCCGCGGCCACCACGCCAAGCGATTCCGTTGCCTCCAAATACGCCTTTGCAGAC
GCCATCTCCTGCCCCTGCTACCGGTGAACCGCTGCGCCTGGTGACCTCAAAGACTTTGAACGATTTGAAGGCTGGGGATT
TGTCTATGTTGGTGCCCTCAAGTCCGTCGACGAAGTCCGAGAACAGCCTGGATAGCCCAGCCGGACAATCTGTTCGGATG
CGGATCTTCAAAGGCTTCGTCACCGAGGAATATCCCGATCTTCTGCTTCCTCCCAATGCGCTGCCGTCTGTCGACATCAA
GGTGGCTTCGTCGCGTATGAAGCCGTCACGCGCCAGTTTGCTTTCCCTGACGCAGTTGGAGGAAGATCCGGTTTTCACGC
TTGCTGTTTTTTCACGAGCTGATGGCGGCGAACTCTGGCGCGTGGAAAAGGACTCTCTGTCTCTGATCAAGCTGGACCAA
CGCATGAAGCAGTGTGCAAGCTTCACGGCGAGGACGCCAGACCGATCGCTTTTTAGCGGACACGCGCCTGCCAAGCTCGA
CGCTCGACGCCAGGCTCTCGACAGTTACCTTGACGAGTTGGTGAACACACCGCTGGACACGAACACGGCCATTGAGCTGT
GCCGGTACCTCTCGACAAGCACGCTACCACCCAATGCCGACGAGAACGGCTCCGCGTCGCCCGTGGTAGCAAAGGAGGGC
AAGGTCATAACTCACAAGACCGGTGCTGGCGGGCGTCCCCTGATGGCCGGCTACCTCACGAAGCGCGGCAAGAACTTTGG
TGGCTGGAAGGCTCGCTTTTTTGTTCTGGATGGCCCGGTTCTCAAGTACTATGAGACACCTGGCGGTGCCCATCTGGGAA
GCATCAAACTACGAAACGCTCAGATTGGCAAGCAGTCGCAAAATAGCGACAACTCGTCGCCCGGGCGGCCAGGCGGTGGT
ACAAATGACGATCTGGACAATCAGTACCGGCATGCTTTCCTGATTTTGGAGCCTAAGAAGAAGGACCCTAGTGCACTCAC
TAAGCACGTGTTGTGTGCTGAGAGTGATCGGGAGCGTGACCAGTGGGTAGACACCCTGCTTCGGTGGATTGACTACCGCG
ATCCGGACGACGACGACGATGTGCCGGTCAATTCCAGGAGGGAGCCAGAGAGGCAGCAAGGGACACATGGGGCGCATGAT
GGTTCGCGGCCCAGCACCTCCTCTGCGTCCAAGAAGAAGTTCAACCCGGTCAAGAAGCCGCGGCAGCATCAGAACAGCTC
TGCCGACAGCAAGGACGGACTCATCGGCATGAGCTACGACAATGTGCAGGCAGGGGAGACACCACAGGGGGCCCCGGGAT
CGCGGCATCCCGAGTCGGAGGCACCACAGAGCACAATGTCGCAATCGCCATACGCAATTTCAGCACCGCGGGATCCCCAG
GTCCTCACAGAGTCGACGCCTTGGACCAACCGAGCTCTTCTCGGAGGAGGACTTGCGCCGCCATCGGTGGAAGAGAAGAA
GGCTAGGAAGCGCAGCTTCTTTGGATTTGGCCCGAAGACGCGCACACCTGGCGAAGGATCCCAGGACACGCTGTTTGGCG
AGTCGAATGGCGGCACCGGTCATGGCAACGTTAGCAATGGAGGCTACGGCGGACCGATTCGGCAGGTATTCGGAGCACCG
TTGGCAGAGGCGGTGCACTACAACTCGCCTACCGACGTGAGGGTGCCGCTGCCCGCAGTGGTGTACCGCTGCATTCAATA
TCTCGACGCTCGCGGCGCCACGACGGAAGAGGGCATATTCCGCCTGAGCGGGTCGAACATTGTTATCAAGCAGCTCCGAG
AGCGGTTCAACAACGAGAGCGACGTCAACCTGCTGGTGGACACAAACTACTACGACATCCACGCGGTGGCCTCGCTGCTA
AAAATGTACCTGCGGGAGCTGCCGACGACGATTTTGACGCGCGAACTGCACAATCAGTTTCTGACCGTGACCGAGATGTC
CGATCAAGACGAGAAGCTGGCCGCGCTCGGCGAGCTGGCCCTGCGACTGCCCGAAGCCAATGCCACGCTGCTCAAATACC
TGATTGCGTTTCTGATCAAGATCATCAACCGCGCGGACAAGAACAAGATGACGGTGCGCAATGTCGGGATTGTGTTTTCG
CCGACGCTCAACATCCCTGCGCCTGTCTTTGCCATGCTACTGCAGAACTACGCAGCGATCTTTGGGATCGAGCCGGAGGA
GTATGAGCTGTCTTCGCCGGCAGCGGACGGCCTGCACCAGCAGCACCCGTCGGTGACGTCGTTGGAGATACCCCAGCGCC
AGTCGACGGCGCAGGCGTCAGAATCGCCTCATCGCCAGCGGCTGCTGGAGGCCATGATGAACGGCAACCTCAATAGCAAT
CGAAACACGCCCACGCCACCTCCGATTGTGACGAGTGCGTCCATGCCGCAGTTCTCACAGCCGCGATTGGCACCGACACC
ACCGCCAACCATGGCAAGCCAGCAGCAGCAACATCGTGTGACGGCTTACGAACCACAGTACCTTCTACAGCAGCAGGGAA
GCGGCCAGGTCCCGTTCCGTCCGGCATATGAGAGTGGCTTTGTGGTGCCTCAGGGATACGACGCGACTCAGATGCCTGCA
GCTACGGCGAACAACCCAGGCTATGACCGTCCGATCTATGAGACGAACGGCTCTGGGCCGGTACCCTATGACAGCAGTGC
GTTTGGGGCGAAGGCCAGCAGCCGGCGCGAAAGCTCCATCTTCCCGGGCGGCATTGGCATGGGCTTGAATTCGCAGGGCG
CTCGAAGCCGGCTGCGGGAGGAAAACCGGTACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62