GenePrediction:GLEAN_1374 Details

Name: GLEAN_1374
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:128550..129857 (+ strand)
Length: 1308
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:128550..128569 (+ strand)
Length: 20
Type: CDS
Source: GLEAN
Position: GCSC_168:128626..128639 (+ strand)
Length: 14
Type: CDS
Source: GLEAN
Position: GCSC_168:128703..128903 (+ strand)
Length: 201
Type: CDS
Source: GLEAN
Position: GCSC_168:128960..129084 (+ strand)
Length: 125
Type: CDS
Source: GLEAN
Position: GCSC_168:129144..129857 (+ strand)
Length: 714
>GLEAN_1374 class=GenePrediction position=GCSC_168:128550..129857 (+ strand)
ATGGCTTCCAAGATCTTCATGTAAGTGGCGCCGTCGGGCGAAACTACGGTCAGAACAAAGCTAACCCAAGAAATAGCACG
GGGGTGACTGGTATGTCGGCAGAGTGCATGCTCAGGAGGTGACAATTGGGGGTGCTGACAAGGCTTTGCACAGGCTACGT
TGGCGGTGATGCTTTCGCGGAGCTGTACGCAACACACCCAGAGCACGACTACACCTTGTTTGTGCGCAGCGAGGAGCGAG
CAGAAAAGATCAAGGCGGCCTATCCAAAAGCGAAGAACATACGGTTCGCATATGGGACTCTGGATGACGCAGAAGTGCTG
AGCCGCGAGGCGGCAGCTGCGGACGTGGTGCTGCGTAAGACTTTGGGTGGTAGCGAGTCTTTGAGGGAGACGGAGGGCTG
ACCGCTGCAGATACCGGAGCGTCGTCTGACAGCATACCGGCTGCCCAGGCGATTGTTAAGGGCATTGAGGCGGGCCACAC
GGTGGAGCATCCGGGGGTGTACATTCACATTTCAGGAACGGGTATACTTACATGGGTGTGTTTCCTCTCCTTTTGACCAG
TCAGCCTTTGTTTCTGGGTTCGCTGACCGGACAGTACGACATGCTCCACGGCCGATGGGGTCAGCCGCCGGTGGCGGAGC
AGACGTATGACGACGTAGCGGGAATCGAGCAGATTCTAACGCTGCCTGACGCGGCGCCGCACCAAGAAGTGGACAAGGTT
GTTCTGGCAGCCGCAGCGACGACGGCAGCGATGCGCACGGCCGTGGTGACGCCGCCGCTGATCTACGGCATCGGCCGCGG
CGCGGGCAACCGGCGCAGCATCCAGGCGCCGGCGATGGCGGCGTACGTGCTGCAGCGCGGCTACGGGCCCGTGGTCGAGG
GCTCGGGAGAGACGGTCTGGGACAACCTGTATGTGCGCGACCTGTCGGCACTGCTGGTCCGGATGGTCGAGGCTGGTCTG
CGTCCGGCCGAGCGCGACGACGACGACCTCTTTGGGCCGCGGGCGTACTACTTTGCGGCCAACGAGACGGTGCACCGATG
GAGCGACCTGGCGCAGTGGCTGGCCGACAGTGCGGCAGAGCAGGGGCTGGGAGGGACCGGCACCAAGAGAGGCGTCGTCA
AACAGGTCCCCATGGCCGATGTGCTTGGTGCTGGTGCGTCCGGTCACGTGACCTGGGGCACCAACTCGCGCGGCAATGCG
GTGCGAGCGCGCCAGTTTCTGGGCTGGAAGCCGACGGGACCGAGCCTGCACGACGAGGTGGCAGCCATAGTAGCTTTTGA
GGCAGCGCGACTGGGAATCAAGGGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62