GenePrediction:GLEAN_1375 Details

Name: GLEAN_1375
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:133214..134931 (+ strand)
Length: 1718
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:133214..133366 (+ strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_168:133471..133596 (+ strand)
Length: 126
Type: CDS
Source: GLEAN
Position: GCSC_168:133655..133732 (+ strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_168:133799..134484 (+ strand)
Length: 686
Type: CDS
Source: GLEAN
Position: GCSC_168:134544..134931 (+ strand)
Length: 388
>GLEAN_1375 class=GenePrediction position=GCSC_168:133214..134931 (+ strand)
ATGGCCTCCCGAAGACTGGCTCTGAACCTCGGACGCGGCCTCAAGGCCCCTCGCGCTGGTCTTTCGCTACCTCCGCTGCG
CCGAGGCCTCGCCACCCCCGTCACCTCGCCGGGCATCAAGGTCCAGTCCACCACGCTCAAGAACGGTCTTACGGTACGCT
CCGACATCACAGCCGCCCAATTGACTCCTTCCGCACCCCCCGTCAGCTTCTGCTCTGCCCTGCTTGCTTCTGTCTTGCTG
ATCATCCTTTCTGCCAGGTTGCGTCCCACTACTCGCCATATGCCCAGACCTCGACTGTCGGCGTTTGGATCGACGCCGGT
TCCCGCGCCGAGACCGAGGAGACCAACGGCACCGCCCACTTCCTCGAGCACCTTGCCTTCAAGGTATGCCTGTCTTTCTC
CCCCGCTTCGAATATCCTCAAAAGCTGACTGTCGGATCTAGGGCACCAGCAAGCGCACCCAGCACCAGCTCGAGCTGGAG
ATCGAGAACCTCGGAGCTCACCTAAACGCATACACTTCGGTTGGTTCTTTCCTTTCTTTCCCTTCTCTCCCTCTCCTCTT
CCCTTCTTTCCCACTAACCCTCCAGCGCGAAAACACCGTCTACTTCGCAAAGGCCCTCAACGAGGACGTCCCCCAGTGCG
TCGACATCCTCGCCGACATCCTGCAGAACTCCAAGCTCGAGGAGTCCGCCATTGAGCGCGAGCGCGACGTCATCCTGCGC
GAGTCCGAGGAGGTCGAGAAGCAGATCGAGGAGGTCGTCTTCGACCACCTGCACGCCACCGCCTTCCAGCAGCAGCCGCT
CGGCCGCACCATCCTGGGTCCTCGTCAGAACATCCAGGACATCACCCGCACCGAGCTGTCCAATTACATCAAGAACAACT
ACTCGGCCGACCGCATGGTCCTCGTCGGCGCCGGCGGCTTCGCCCACGAGCAGCTCGTCGAGCTGGCCGAGAAGCACTTC
ACCAGCCTGCCCGCCACGTCGCCGCCATCCGGCGCTCTGTTGGAGTTCAAGAAGAAGTCCGACTTTATCGGCTCCGACGT
CCGCGTGCGCGACGACACCATCCCCACCGCCAACATCGCCATCGCCGTCGAGGGTGTCAGCTGGAACGACGACGACTACT
TTACCGCCCTCGTTGCCCAGGCTATTGTCGGCAACTACGACAAGGCTCTCGGCAACGCCCCGCACCAGGGCAGCAAGCTG
AGCGGCTTCGTCCACAAGAACGACCTGGCCAACAGCTTCATGAGCTTCTCCACGAGCTACAGCGACACTGGGTGAGTTTG
ACGCCTTTTGCCTTTTGCCTTTGCCGTCTTCGTCTGCTGACCCCCTCCAGTCTCTGGGGCATCTACCTCGTTACCGACAA
GCTGACGCGCATTGACGACCTTGTACACTTTGCCCTGCGCGAGTGGTCGCGGCTGTCGCTGAACGTATCCCAGGCCGAGG
TCGAGCGCGCCAAGGCCCAGCTCAAGGCGTCCATCCTGCTGTCGCTGGACGGCACCACCGCCGTGGCCGAGGACATTGGC
CGCCAGATCATCACCACCGGCACCCGCCAGAGCCCTGCCGAGATCGAGCGCGTCATCGACGCGATAACAGAGAAGGACGT
CATGGACTTTGCCAACCGGAAACTGTGGGACCAGGACATTGCCATCAGCGCCGTCGGCAGCATCGAGGGCCTGTTTGACT
ATGCGAGAATCCGGGGAGACATGAGCCGGAACTTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62