GenePrediction:GLEAN_1377 Details

Name: GLEAN_1377
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:148166..149721 (+ strand)
Length: 1556
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:148166..148773 (+ strand)
Length: 608
Type: CDS
Source: GLEAN
Position: GCSC_168:148836..149721 (+ strand)
Length: 886
>GLEAN_1377 class=GenePrediction position=GCSC_168:148166..149721 (+ strand)
ATGGCGACACCACGGTCACCAGCACATGGAGAGGACGACGACTTCGGTGAGGAATGGGCCCACGACCTGCGGCTGCGCTT
CGAGCAGATGCTGTCGACCCGTCGGTTGAATCACATCAGCCAGGCACGCTCACGGCACGGCTCACTATCACCACGAGAGG
CCACTTCGACCAGCGACCTCCGTACCCTTTCGGCCAGCCCAGTAGATACGGCACGCCCGTCCACCTCCTATGGCGGCGAC
CAAAGTCACCACGTTTTTGGTTTTCCTGGTGGCAGCGGCCCGTCGTCTTCTTCCTCTAGTGCGCATCTGCCTCCGACACC
ACCGGCCTACTCTTCGCTGCGCAACCTTCCGATGATCCCCCGGGCACCAAGTCCGAACGACCGGGCTGAACAGCAGTTTC
GGAGCCTGCTCGTCACCCTGTCCACAACGCCGCTCAAGTACGAGAACCCGGGCTTGCTGGACGAGGCGCTGCAGGTGATT
CCCCTGGATCGCATATACAGCGAAGCCGACGAGGAGAGCCAGGTGTTTTGTGCCGCAGCCGAAAGCATGGGCGACGGCCG
GAAACCGGAATGGGGCTACCAGGACTGCGTCATCCGCGCCCTACTAAGGTTTGTATCCTCCCCACTAGAGGTGGTGCTTG
TTGCTCTTACTGACACGGCGTGTCTTGTAGATGGTTCAAGCGGTCCTTCTTCACATGGGTCAACAGTCCGCCATGCTCCG
TGTGCTATTCGCCTACCATCGGCCGGGGCAGCACGCACCCGACGCCCGAGGAAAGCGCATACGGCGCTCTGCTGGTCGAG
GCGTACCAGTGCGCAAACCCCGCCTGCGGCGCCTACGAGCGCTTCCCCCGGTACAGCGATGTATGGAGACTGCTGAAGAC
CCGACGCGGACGGTGTGGCGAGTGGGCCAACTGCTTCAGCATGCTGTGTCGTGCCGTCGGCGGCCGCGTGCGGTGGGTGT
GGAATGCGGAGGACCACGTGTGGACGGAAGTCTACTCAAGCCACCAGAAGCGATGGGTGCATGTAGACGCATGCGAGGAA
GCCTGGGACAACCCGCGGCTATACACCGACGGCTGGGGCAAGAAGATGTCCTACTGCATCGCCTTCTCGATTGATGGCGC
CACCGACGTGACCCGCCGCTATGTTCGGAAAAGCGAGCACTCGCTAGAGCGCAACAAGAGCCCGGAGGCCGTCCTGCTGT
ACATCATGCAGGAAATCAAGAATCTACGCCGTGCCAACGTGAGCAAGGACGAGCGATTCCGGCTGGAGAAGGAGGACTCG
CTGGAGGACCGCGAGCTGCGGCAGTACGTGGTCAACTCCATCGCCCAGGCGGTGACACGGCTGGTGCCCGGTGCCGTTGC
CGGGTTAGAAAGCAGCCACCGACGGCCAGACAACATGGACGACGCCAAGCTGCCTGCCGAGCTGCCGGTTCGCCAGAGCG
GCAATGCCGAGTGGGTGTCTGCGCGCGGTGAGAATGGCCGGCGGCAACAGCCGCAGCATCCATCCCCACAGCCGCCACAC
GGCCCTCAAGACCCAACATTCCGCGGATTCCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62