GenePrediction:GLEAN_1378 Details

Name: GLEAN_1378
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:150706..152231 (+ strand)
Length: 1526
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:150706..151141 (+ strand)
Length: 436
Type: CDS
Source: GLEAN
Position: GCSC_168:151207..152231 (+ strand)
Length: 1025
>GLEAN_1378 class=GenePrediction position=GCSC_168:150706..152231 (+ strand)
ATGTTTCCGTCTGTACGGCGCGTGGTGGTGGCCTCGTCCACGGCGCCGCCCCGGGCGTCGCCGGCCAGCACGGCCTCGGC
AGCAGCAACGGCAGCGGCGGTGGTGGTTGGCGTGTCGCTTGGGCGGTCGACGGGCAGCCGTCGGCCACAGCAGACGCTGC
CACAGCGGCGGTACTCGTCGTCCAAACCGTCGAGCCCCGATAACGGGTCCAAGGCGCTGGCCGGCAGCGTGCCGTCGTCG
TCGACCAAATCGAGCTCCTCGTCATCCTCCTCCTCGTCCTCCTCGTCCTCCTCGTCCGCCACCGCCTCATCCTCCTCTTC
CTCCTCGTCGGCCTCGTCGTCCTCTACCCCGAAGCGTAAGCGGAAGGCCAAGGAGCCCACCGCCTCTGTTCAGAAGCTGC
CAAGCGTCCCGTCGACCCAACATTTGCCCCTGGAGAGTACGTATTCTTAGCATCTCTGCGTTCGGTTTCTGCTTGTCTAA
CTGTCCTTTCTCTCTTTCTAGCCCTTGCTCTCTCCAGCTTCTTCTCCCAACATCGCCCGATCTCGATCACGCATAGCCTG
CCCAAGATCGTGACCGACGACGCCTTTGCCGCCATCTTCGCGCCGCGCACCAAGGGAGGCCTGGCCGGCCGGATGGCGGC
GGCAGGGTCGACCGGCAGCAGCAGCGGCAGCCAGACGTCGAATGTGATTCGCACGCTGACCCGTGCGGTCAACGACCTCG
AGTCGCCCATGGTCAACGTGTCGCTAGACGACGACGGACGCGGTGGCACGAGCAGCCGGCAGCGGGACAGGACTGTGGAA
GAGCAGATCCGGCAGCGGCAGCGGCAGATTATGCAGCAGCAGCAGCAGCAGGCAGCGGCCGATGCGGCGGCCGAGGCAGC
TGACGGGACAGACTCAACGATCGAGCTCAAGAACGCAGACGGGTCTAGCTCGGGCATCCACGTGCAGCTCAGCACGCTGT
CGGGACGGTTCTTGCCGTTCCAGCCGCCGCCGGCGCCGGTGCCGATGTCGATACTGACGAGCGCCGAAGAGGCTGCGGCA
ACCGAGGCGATGGAGGCCGATTTAGACGCTGCAGCAGCAGCCGATGCAGCAGCCGAGGAGGCCGGTGCTGCTGTCGTGGC
TGACGGGCGCATCTTCAAGGCGGTGCTCAGCTTTGGCGAGCAGCTGGGTGAAGACGGCCAGATGCACATGGTGGCCCAGT
CGCTGCAGATTGTGCAGGAAGAGGATGGCGCGGCCGAGCACAACAACAACAACAACAACATGTCGACCGTGCCGCGGTCT
TTCTTTGAGCGCATGGCCCTGCGACAGCTCCGGTTCGAGGACGCGCTGCAGCGGCAGCGGGAGGCGCGCCAGGAGCAGCA
GCACCGGGAGCAGAAGGACCGCTACGATGACGCGGGCGAGAAACAGCGGCCGCGCATGCTGGCCATCAGCGTCAAGCGGC
AGAAGAAGCTCAAGATGAAGAAGAAGAAGTACAAGAAGCTGATGAAGCGGACCCGAAACCTGCGACGGAAGCTGGACCGC
AACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62