GenePrediction:GLEAN_1381 Details

Name: GLEAN_1381
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:159682..166130 (+ strand)
Length: 6449
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:159682..159706 (+ strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_168:160914..161701 (+ strand)
Length: 788
Type: CDS
Source: GLEAN
Position: GCSC_168:161793..161893 (+ strand)
Length: 101
Type: CDS
Source: GLEAN
Position: GCSC_168:161959..165124 (+ strand)
Length: 3166
Type: CDS
Source: GLEAN
Position: GCSC_168:165195..166130 (+ strand)
Length: 936
>GLEAN_1381 class=GenePrediction position=GCSC_168:159682..166130 (+ strand)
ATGTCATATGTAGTAGAGAAGAATCGTAAGTAGCAAAGCGAGTGTGCTTCTTTTTTGTAATTAGACTGATCAATAACATA
TTGTATTATGGGTTCTATCTTATTAGCTTGGCCATTCATCTAGATATGTATCATCATTATCGCGGCACAGTAGAGCACAG
AACTTGCAAAGTACTCGTACGGAGTATGTATCGGCACCGTGAGCTTTTACGAGGAAGACTTGTATCTTACCGCTCACGCT
AATATGATAGCTGCTTCACCGCCTTGACATAAAATTTCATCTGCGAATGTTCACAGTTTCCACAGTTCGCTTCTCTTGAC
ACATTGTTTATTGTCCTACTGCCAAACGTAAGTTGTTGAAGACTCCGCGTACGTCTATCTAGCTTGTCAGTAAGGAAGCA
TAGTGCCCGGAGTCCTATGAAGTACCGTGAATAGGTCTACTCCGTAGGTGGCCGAAATATGGCCGGCAGAATGCAAACGG
TCTCCCACGTAAGTCTAGTGCATTATCCGACCAATCAAGTCCGGCCAGATGCATTACAGTGCGTATAGGAACAACTTACG
GTGCTGAAACCTCACAATGACAATGCCGGCGACCGGTTTCGTATGACCTTGAAGCGATACCGCAGACACCACGTGACTAT
CTGCATCACAGTTACTGCAGACGCGACGCTTATCGTGCTCTTATCAGGCCGGGCCGACAGAAAATCCAGCCCTCCCCTTT
CTTTTGTGCCGTGACGCCAGTGTGAACAGCTGGGAATCGCTTCGGCTTTCGCGCAAAAACTCTCTTTCTCTCCTCCCCTT
CACCCGCGCGTTGTCTCGTTTTTCGCACCAGTTGCCTGCTCAACGTGCGTTTTCTGGAGCCGATCTCGTCTGGTATTGAT
ATACCCGATTTTTGGGCCCTCTGCATTTGGGGCATTTCGACCGAAACACAACTCTGACACCCCAAAACACGGTCATCTCA
CACGGCTGCGGCAGCCCTGCAGAACGACTCTGAGAGGCCAGCAAGAGAGGGTTGTTTGTTCCCAGGTATGCAGCTTACTC
ATGCGATCACACGGGACAGATTATTGCTTTGCTCTTACAACTTCTCTGTATTTTTTCATTGCGTGTTACCTAGTTCTCAA
GCTCTACTCGCTTTTTTTCTAAAGTCGTTTCGGCCTGCTAACAATTGTTTTTCCGCCCAGGATTTTCACCGTCAGCACCC
GTCGATCAATAGATGCCTTCCGTTTCCCCGAGCTAGGGACCTCCATCGGCGAGCCATGAACAACGCTCATCCCCCGCTCC
ACGGCGTCGGCTTCGATCGCGACCGTGAGCGCGAACGCGAACTCGACGAGCAGCGAAATCGGGTTATCCACCACCAGCAG
GAGGAGACAGCCCTCCGCGAACGCGAGCAGCGGGAACAGGCTGAGCGTCACCAGCGGGAGGCATACTCCGGCCCTCTGCC
TCCACAGCAGCAGCAGCAGCCCGGCCCGCCTCACCACAACTCTGCCGGCTCCATCCCGATCCACCAGCCGGTCGCGTCTC
GTATTGCCGGTGCCATCCACAGCCCAAATGGCCTCCTGGCTAACCACGGTGGTGGTGCAGGCAATGCGCCGCCTCCGCCT
CCGCCAGGCCAGCTGGGCGGTCCGCCGCCGCAGTCCGGAGGTGTTTCGGGATACGGTGGCCCGCCGCCCTCAATGCACTC
GGTGGGTGATCAGGGCCGTCCACACCCCTCGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAACAACAGCAACAGCAGC
AAATGTACCCGATGATGACACACGGCGGCTCCTCTGTGCCGATGAACGGTGCTCTTGGGGGGTCTGGTGGTCCGGGCTCA
ATATTTGGCGGGCCTCTTCAGCCTGATAACCGTGCTGTCCAACCGCCTCCACCTTATGGTACTGCCATGGGTCCAGGCCA
TGGCGGTCCTCCGGGACCGAATGGTGCTGGCGGTCCTCCTGGTCCATCCGGTCCCGGCGGACCAGGTGGTGTGACACAAG
GACAGCAGCCTATTCTGAATGTAAGTACTGTCGTCGTTACCTTCGTCCTCTGTCTGGTGACACTGGCTGAGAGCACCCTT
ATCTGACATGTCGTTTTCGTCCGTTCTATAGGACGCGCTCAGCTATCTCGACCAAGTCAAGGTTCAGTTCCATGAACAAC
CGGATGTTTACAACCGCTTCCTCGACATCATGAAGGACTTCAAAAGCCAGACGTAAGTGAACGGTCTCGGGTGTTCCTGG
CCCTGTGTGGCCTTGGAGCTAATCAATTGCTCCTCAGAATCGACACTCCGGGCGTCATTAGTCGTGTGTCCGATCTTTTC
GCAGGCCATCCCAACTTGATCCAAGGGTTCAACACCTTTCTGCCGCCGGGGTATCGTATCGAGTGCGGCCTCGAGAACAA
TCCAAACAGCATCCGGGTGACAACGCCATCTGGCTCGACCATCCACTCCATCGGGGGAAGCAGAAACCTGCCTCCCGAAG
CCCACGCGCCTCAACCTGGGCTGGGCAACATGTTTATGGGCATGGGTGGCCGGCCCTGGCCGCCGCAGCAGCAGCAGCAG
CAGGTGCAACACAGCGTCGAGGGTCCCGAGGGCCAATTTGGCGGCCAGCCACAGAACATCCCACCGCCCGGTGTTCCTCC
TTACGGCCATGCTGGCACTGCTGGAATGTACGACAACATGCCGCGAGGCAGCCATGCTGGTGTTCCTGGCGGGCCGGGGA
TGGCCATGGGAATGGCAGTCCATAACTCTGCGGCGCCACGAAACGCACACACGCCGGCTCCTGGGGCTGGCGCAAACGGC
GCTGCGGCTCAGCAGCCTGGTGGCGAGAAGCGCGGGCCGGTGGAGTTCAACCACGCCATCAGCTACGTGAATAAGATCAA
GAACCGGTTCCAGGACAAGCCGGAAATCTATAAGCAATTTCTGGAGATCCTGCAAACCTACCAGCGCGAACAGAAGCCGA
TCCAGGAGGTTTACGCCCAAGTCACGACACTCTTCAGCGGTGCGCCGGACCTGCTTGAAGACTTCAAGCAGTTTCTTCCC
GAGTCGGCAGCTCACGCACGTCCGGTCGGCAACCGTCCGGGCGAGGAGGCGAACGGGGCCGGCAACGCTGTGCAAACCAC
GCCGCCCAGCCAGAACGCAGACGGGCCAAAGATGCCGCCGGTGGGGAACTTTGCGCCGCCTTCGAGCACAGCCAAGGAGA
GCAAGAAACGGCCGCGGCAGGAGAAGCCGCAGGCACCGATGCCGGCGCCTGCTCCCGTGGACCTGACGACGGCGACATCT
TCGGTTCGTGGGTTGCCGCCAGCTGCGGCCAACAAGCGGGCCAAGCTCTCGCACAAGCCGTCTGTTGATGCAGCCGTGTC
CAGCACAGAGCCGACGCTGACGCCGGTGGTCCCAGAGCCACTGGCGCCGACTGGGACGATTCAAGACATGCAAGAGGGCC
TGAGCTTCTTTGAGCGTGTCAAGAAGTACCTGCCGAACCGCACGACGATGAACGAGTTCCTCAAGCTCATCAACCTGTAC
CGGCAGGGCCTGATTGAGTTGAACGTGCTGGTGGCCAAGAGCCACGTGTTTATTGGTGGCAACCCGGAGCTCTTCGGCTG
GTTCAAGAACCACCTCGGATACACGGGCGAGGACGAGATCATTGAGAACCGTCCGGCGCCTCCGAGCGGGCGGGTGTCGC
TCAGCAACTGTCGCGGCTACGGTCCCAGCTACCGCCTTCTCCCGAGACGGGAGCGGTTAAAGCGCTGCAGCGGTCGCGAT
GAGCTCTGCAACTCAGTCCTCAACGACGAGTGGGCATCCCACCCTACGTGGGCGTCGGAAGATTCCGGGTTCGTTGCCCA
TCGCAAGAACGGATACGAGGAAGGATTGCACCGCATCGACGAGGAGCGTCACGACTACGACTTTTACATTGAGGCAAACC
AGAAGTTCATACAGCTTCTGGAGCCGCTGGCACAGCAGATGCTCACGCTCTCGCCGTCGGAGCGGGAGAACTTCCGGATG
CCTCCCGGACTTGGTGGGCAGAGCACATCGATCTACAAGCGGGTGCTGAAGAAGGTGTATGGTCCCGACCGCGGCATCGA
GGTGGCCAACGACATGTTCAGCCACCCGTTTGCGGCAGTGCCGGTGATCATGGCGCGGCTCAAGCAAAAAGACGAAGAGT
GGCGGTTCTCGCAGCGGGAGTGGGAGAAGGTGTGGATGGCGCAGACGGAGGCGATGTACCTCAAGAGTCTGGACCACATG
GGGATCCAGGTCAAGTCGAACGACAAGCGCAACCTGTCGGCGAAGCACCTGGTGGACCTGATCAAGACGAAGCGCGAAGA
GCAGCGGCGGGCGGCGGCACTGGGCTCCAAGATGCCGGTATACCAATTTCTCTGGGACTTCTCGGACCGCGAGGTGGTGC
TGGACCTGCTGCGGTTCATGGTGCTGTACGTGCTGCAAAGCGGACAGCACGGGGCAGCCGAGAAGGAGCGAATCACGGAG
TTCTTCGAGACGTTTGTGCCGCAGTTCTTCGACCTGCCAGAGGAGGTGGTGCAGCAACGACTCAGCGACATCGACCGGGA
CTCGGGCGACGAGGATGGCGACAGCGGACTGCCAGCAGAGCTGACCAACGGACGCAGCCGACGGACGACGAAGAAGTCGG
ACTTGCTGCGCGGCGTGCTGGACCCAGGACGGAACGGGTCGCGACAGTCGCGCAACCACAAGGAGGGCAGTGCGGCGTCG
GGATCCAAGGAATCGACACCGGACGTGCACTCGGCAAACGAGGAGGAGATGCCGGACGCACCGACGGTGGCCGAAGAAGG
GTCATCGCTAGAGCTGTCGAACGAGCGGTGGCTACCGGCGGCGCCAGGGCCGACAGTAGTTTCGGGGGCGAATCCGTTGG
CGGAAAGTGAACGGGAGCTCAAGGCGGACGGACTCTTCCGGCGACAGTGGTACAACTTCTTCTGCAACCAGACGGTGTTT
GTCTTCTTCAGCGTCTTCCACCAGCTGTACGAGCGGCTCAAGGCGGTGAAGGAGAGCCGAGAGAGCGTGCTGGAGGAGCA
GCAGCGGGAGACGGCCGAGAAGCCGGGCCGGGCGCTGGGGATGATGTCGGAGCCGATGCGATACTTTGACGGGGCCGTTG
GCGAGGCGTTCTGGCCGCGGACGGTGGAGCTGATCGAAGACTTTCTGACGGGCGAGATCGAGGAGAACCGCTACTTTGAC
GTGCTGCGGCATTATTACCTGCGCAAGGGCTGGAAGCTATACACGATCCAGGATCTACTCAAGACGTTGTGTCGGCAAGC
GCTGGTGTGCAGCGGGTCAGACTCGCGCGAGAAGACGCTGGAGCTGGTGCAGCAGTTTCTGGTCAGCCGGCAACTGGACG
AGACGTCGTACCAGACCGAGATCAGTGCGCGCAAGTTTGCCGAGAAGTGCATCAAGGACGGCGAGATGTTCCAGATTACC
TGGGTGAGTTTTGTTTGTGTCTCTTCCTCCTGGGCCAGCTGGCCTGGTCGTTTGCCCATGTCTAACAACATAGTATCCGG
CCAAGAACGAGACGACGGTGCGTTGGCTGCAGCGTGACGAGCCGACCTTTAACGTGGACGAGATGGCGCTGCGGGAGCGC
TGGCAGTACTACATCTCGTCGTACATGCGGATCGAGCCGACCGAAGGCGTGCATAGGGCGCGGCTGCAGAAGTCGGTGCT
GGCCCGCAATCTGCCGGTGGCGAGCGATGCGGACTCGGACAGCGGTGACGGCCGGAAGGCGCTGGCCTTTCACGAGGGTC
TGGTGCTGCGCATCTGTTTGAACTCATACACGATTGTGTACGAGAAGGGCACGTCCGAGTACTTTATCTACAACCACCAG
GCGGCAGTCGAGGAGGCCGTGGAGGACGAGGACAAAGACGGACGCGAAGACATGGACAACGAGCTCGACAACGAAGATTT
GACTGAAAAGGAAAACGAAAGCGAAAAGGACAAGCCGTCCGGCCAGCCGAGTCGACGTCGGCGGGCAGAGCAAGCCCGTC
GAGACTTGGCGCGCCGACGACGCGACTGGCGCGAGCAGCAATTCCGCGAGAAATTTGTCATCAACAACGCCTGGATGAAG
GACCGGACCCAAGACGAGGTCCAGCAGCGCAAGGACGCGTTTGCGCGCTGGGTCGCCGACGGCACGTCGCCCGACGCTGT
CCGGACTTCGGCTGCCGCTGCCGGTGTCGTCGTCGGCAGCAACACCGAAAACGATGGGGCTTCCTTGGTCGCCGCAGCCG
CTGCAGCCGCCGCAGCAGAGACAGCATCAGCCGAGGCTGAGGCAAAAGCCCAAGCACAAGCAGCTGCGGCTGCGATTTCC
GCTTCGGCTGAAGCCCTGGTTTCGGCTGCCGCCTCGGCTACTATCGGCCCAGACGGCCCAGACGGCCTAGACGGCGGCCC
TGGCGAGGACGCGCAGACCAGGGCAACCTCGCAGCAGGCTGCCGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62