GenePrediction:GLEAN_1383 Details

Name: GLEAN_1383
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_168:184774..185907 (+ strand)
Length: 1134
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_168:184774..184825 (+ strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_168:184877..185907 (+ strand)
Length: 1031
>GLEAN_1383 class=GenePrediction position=GCSC_168:184774..185907 (+ strand)
ATGGCACCAATTGCCCAAGCTGTCGTCGTGTCCCTCGAGGACCTCAAGAATGGTGACAAGGCCTCCCCACATCAGAACCC
TGCACCCGGCTGACCAAGCACAGGATCAATCGCGCTGGAAAAGCTGCAAGAGGCCTTTGGACCGGGATCGCTGGGGATTC
TCGTCGTCAAGGACGTGCCGGCCGAGTTTGCCGAGCTGCGGAAGCGGCTGCTGTCGTACGCGTCGTACCTGGGCAACCAG
CCGGAAGAGGTGCTGGCCCGGCTCGAGAACGAAGCGGCCAAGTACCTGACCGGCTGGTCGCGCGGCAAGGAGACGCTCAA
GAACGGCCAGGTCGACACGCTCAAGGGCTCCTACTATGCCAACTGTGCCTTTTACGTCGACCCGGCGCTGGGCTGCGCCA
AGCCGACGGCCGAGTTCTCGCCCGCCACCTTTCCCGAGTACCTCTCGCCCAACGTGTGGCCCGACAGCGACGCCCTTCCC
GGCTTCCGCACCACCTTTGAGGCGCTGTGCCGCCTGATCATCGACGTGGCCGTGCTGGTTGCCCGCGCCTGCGATCGCTT
TGCCGCCCAGGCCATCCAGGGCTACCCGGTCGGCTACCTCGAGGGCGTCGTGGCCACGTCGACCACCACCAAGGCCCGGC
TGCTGCACTACTTCCCGGCCGAGAAGACGACCGCGAGCGAGACCGCAGCATCTGGTGACGGTGACGACTGGTGTGCCACC
CATCTCGACCACGGCTGTCTGACCGGCCTCACTTCGGCCATGTTTGTCGACGAGACCGACTGGACCGCACCGACAGCTGT
AGCCACGGGCCTTTCCCCGCTCGATGAGCTCGCCGCATCGCCTGATCCGGCTGCCGGCCTCTACATCAAGTCGCGCACCG
GCGAGACTGTCCAGGTCAAGATCCCTCGCGACTGCATCGCCTTCCAGACCGGCGAGGCACTCGAGCGCATCACCGCCGGC
CAGTTCAAGGCCGTGCCGCACTTTGTGCGCGGCTCCGCGCCCAGCAGCAGCAGAATCGCTCGCAACACCCTCGCCGTCTT
CACGCAGCCAAACCTGGCCGACGAGGTCGACCGCGAGCAGCACATCACGTTTGGCGAGTTTGCTCGCGGCATCATCACTA
AGAACACAGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62